> This page is for Developer Documentation. > For clean Markdown of any page, append .md to the page URL. > For a complete documentation index, see https://docs.benchling.com/llms.txt. > For AI client integration (Claude Code, Cursor, etc.), connect to the MCP server at https://docs.benchling.com/_mcp/server. # Get a task by id GET https://{tenant_name}.benchling.com/api/v2/tasks/{task_id} Get a task by id Reference: https://docs.benchling.com/docs/api/v2/benchling-api/tasks/get-task ## Authentication - `Authorization` header (bearer token, required) — Bearer authentication of the form `Bearer `, where token is your auth token. ## Request ### Path parameters - `task_id` (string, required) — UUID of the task ## Response ### 200 OK - `Tasks_getTask_Response_200` ## Errors ### 404 Not Found Error Not Found - `error` (NotFoundErrorError, optional) ## Types ### AsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (AsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (AsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### CreateTemplateAlignmentAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (CreateTemplateAlignmentAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (DnaAlignment, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### CreateConsensusAlignmentAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (CreateConsensusAlignmentAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (DnaAlignment, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### CreateNucleotideTemplateAlignmentAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (CreateNucleotideTemplateAlignmentAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (NucleotideAlignment, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### CreateNucleotideConsensusAlignmentAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (CreateNucleotideConsensusAlignmentAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (NucleotideAlignment, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateDnaSequencesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateDnaSequencesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateDnaSequencesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateDnaSequencesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateDnaSequencesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateDnaSequencesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateRnaSequencesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateRnaSequencesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateRnaSequencesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateRnaSequencesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateRnaSequencesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateRnaSequencesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AutofillPartsAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (AutofillPartsAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (AutofillPartsAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AutofillTranscriptionsAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (AutofillTranscriptionsAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (AutofillTranscriptionsAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AutofillTranslationsAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (AutofillTranslationsAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (AutofillTranslationsAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkRegisterEntitiesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkRegisterEntitiesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkRegisterEntitiesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateDnaOligosAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateDnaOligosAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateDnaOligosAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateDnaOligosAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateDnaOligosAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateDnaOligosAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateRnaOligosAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateRnaOligosAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateRnaOligosAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateAaSequencesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateAaSequencesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateAaSequencesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateCustomEntitiesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateCustomEntitiesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateCustomEntitiesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateCustomEntitiesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateCustomEntitiesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateCustomEntitiesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateContainersAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateContainersAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateContainersAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateContainersAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateContainersAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateContainersAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateAaSequencesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateAaSequencesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateAaSequencesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkUpdateRnaOligosAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkUpdateRnaOligosAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkUpdateRnaOligosAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### TransfersAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (TransfersAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (TransfersAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AOPProcessOutputAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (AopProcessOutputAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (AutomationOutputProcessor, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AIGGenerateInputAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (AigGenerateInputAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (AutomationInputGenerator, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### ExportsAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (ExportsAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (ExportsAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### ExportAuditLogAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (ExportAuditLogAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (ExportAuditLogAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateFeaturesAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (BulkCreateFeaturesAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (BulkCreateFeaturesAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### FindMatchingRegionsAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (FindMatchingRegionsAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (FindMatchingRegionsAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### FindMatchingRegionsDnaAsyncTask - `status` (enum, required) — The current state of the task. - Allowed values: `RUNNING`, `SUCCEEDED`, `FAILED` - `errors` (FindMatchingRegionsDnaAsyncTaskErrors, optional) - `message` (string, optional) — Present only when status is FAILED. Contains information about the error. - `response` (FindMatchingRegionsDnaAsyncTaskResponse, optional) — Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### NotFoundErrorError - `message` (string, optional) - `type` (enum, optional) - Allowed values: `invalid_request_error` - `userMessage` (string, optional) - `invalidId` (string, optional) ### AsyncTaskErrors ### AsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### CreateTemplateAlignmentAsyncTaskErrors ### DnaAlignment - `apiURL` (string, optional) — The canonical url of the DNA Alignment in the API. - `createdAt` (datetime, optional) — DateTime the DNA Alignment was created - `id` (string, optional) - `modifiedAt` (datetime, optional) — DateTime the DNA Alignment was last modified - `name` (string, optional) - `referenceSequenceId` (string, optional) — The ID of the template or consensus DNA Sequence associated with the DNA Alignment - `webURL` (string, optional) — The Benchling web UI url to view the DNA Alignment - `alignedSequences` (list of AlignedSequence, optional) ### CreateConsensusAlignmentAsyncTaskErrors ### CreateNucleotideTemplateAlignmentAsyncTaskErrors ### NucleotideAlignment - `apiURL` (string, optional) — The canonical url of the Alignment in the API. - `createdAt` (datetime, optional) — DateTime the Alignment was created - `id` (string, optional) - `modifiedAt` (datetime, optional) — DateTime the Alignment was last modified - `name` (string, optional) - `referenceSequenceId` (string, optional) — The ID of the template or consensus Sequence associated with the Alignment - `webURL` (string, optional) — The Benchling web UI url to view the Alignment - `alignedSequences` (list of AlignedNucleotideSequence, optional) ### CreateNucleotideConsensusAlignmentAsyncTaskErrors ### BulkCreateDnaSequencesAsyncTaskErrors ### BulkCreateDnaSequencesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `dnaSequences` (list of DnaSequence, optional) ### BulkUpdateDnaSequencesAsyncTaskErrors ### BulkUpdateDnaSequencesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `dnaSequences` (list of DnaSequence, optional) ### BulkCreateRnaSequencesAsyncTaskErrors ### BulkCreateRnaSequencesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `rnaSequences` (list of RnaSequence, optional) ### BulkUpdateRnaSequencesAsyncTaskErrors ### BulkUpdateRnaSequencesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `rnaSequences` (list of RnaSequence, optional) ### AutofillPartsAsyncTaskErrors ### AutofillPartsAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AutofillTranscriptionsAsyncTaskErrors ### AutofillTranscriptionsAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### AutofillTranslationsAsyncTaskErrors ### AutofillTranslationsAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkRegisterEntitiesAsyncTaskErrors ### BulkRegisterEntitiesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. ### BulkCreateDnaOligosAsyncTaskErrors ### BulkCreateDnaOligosAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `dnaOligos` (list of DnaOligo, optional) ### BulkUpdateDnaOligosAsyncTaskErrors ### BulkUpdateDnaOligosAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `dnaOligos` (list of DnaOligo, optional) ### BulkCreateRnaOligosAsyncTaskErrors ### BulkCreateRnaOligosAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `rnaOligos` (list of RnaOligo, optional) ### BulkCreateAaSequencesAsyncTaskErrors ### BulkCreateAaSequencesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `aaSequences` (list of AaSequence, optional) ### BulkCreateCustomEntitiesAsyncTaskErrors ### BulkCreateCustomEntitiesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `customEntities` (list of CustomEntity, optional) ### BulkUpdateCustomEntitiesAsyncTaskErrors ### BulkUpdateCustomEntitiesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `customEntities` (list of CustomEntity, optional) ### BulkCreateContainersAsyncTaskErrors ### BulkCreateContainersAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `containers` (list of Container, optional) ### BulkUpdateContainersAsyncTaskErrors ### BulkUpdateContainersAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `containers` (list of Container, optional) ### BulkUpdateAaSequencesAsyncTaskErrors ### BulkUpdateAaSequencesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `AaSequences` (list of AaSequence, optional) ### BulkUpdateRnaOligosAsyncTaskErrors ### BulkUpdateRnaOligosAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `rnaOligos` (list of RnaOligo, optional) ### TransfersAsyncTaskErrors ### TransfersAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `destinationContainers` (list of Container, optional) ### AopProcessOutputAsyncTaskErrors ### AutomationOutputProcessor - `assayRunId` (string, optional) - `automationFileConfig` (AutomationOutputProcessorAutomationFileConfig, optional) - `file` (Blob, optional, nullable) - `id` (string, optional) - `status` (enum, optional) - Allowed values: `SUCCEEDED`, `FAILED`, `NOT_STARTED`, `RUNNING` - `apiURL` (string, optional) — The canonical url of the Automation Output Processor in the API. - `archiveRecord` (ArchiveRecord, optional, nullable) - `completeWithErrors` (boolean, optional) — Specifies whether file processing should complete with errors. False means any error in output file processing will result in no actions being committed. True means that if row-level errors occur, then failing rows and their errors will be saved to errorFile, and actions from successful rows will be committed. - `createdAt` (datetime, optional) — DateTime the Automation Output Processor was created - `errorFile` (Blob, optional, nullable) - `modifiedAt` (datetime, optional) — DateTime the Automation Output Processor was last modified - `progressStats` (AutomationProgressStats, optional) — Processing progress information. - `transforms` (list of LabAutomationTransform, optional) ### AigGenerateInputAsyncTaskErrors ### AutomationInputGenerator - `assayRunId` (string, optional) - `automationFileConfig` (AutomationInputGeneratorAutomationFileConfig, optional) - `file` (Blob, optional, nullable) - `id` (string, optional) - `status` (enum, optional) - Allowed values: `SUCCEEDED`, `FAILED`, `NOT_STARTED`, `RUNNING` - `apiURL` (string, optional) — The canonical url of the Automation Input Generator in the API. - `createdAt` (datetime, optional) — DateTime the Automation Input Generator was last modified - `modifiedAt` (datetime, optional) — DateTime the Automation Input Generator was last modified - `transforms` (list of LabAutomationTransform, optional) ### ExportsAsyncTaskErrors ### ExportsAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `downloadURL` (string, optional) ### ExportAuditLogAsyncTaskErrors ### ExportAuditLogAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `downloadURL` (string, optional) ### BulkCreateFeaturesAsyncTaskErrors ### BulkCreateFeaturesAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `features` (list of Feature, optional) ### FindMatchingRegionsAsyncTaskErrors ### FindMatchingRegionsAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `aaSequenceMatches` (list of FindMatchingRegionsAsyncTaskResponseAaSequenceMatchesItems, optional) ### FindMatchingRegionsDnaAsyncTaskErrors ### FindMatchingRegionsDnaAsyncTaskResponse Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. - `dnaSequenceMatches` (list of FindMatchingRegionsDnaAsyncTaskResponseDnaSequenceMatchesItems, optional) ### AlignedSequence - `bases` (string, optional) - `name` (string, optional) - `pairwiseIdentity` (float, optional) — Fraction of bases between trimStart and trimEnd that match the template bases. Only present for Template Alignments; Will be empty for Consensus Alignments. - `sequenceId` (string, optional, nullable) - `trimEnd` (integer, optional) - `trimStart` (integer, optional) - `dnaSequenceId` (string, optional, nullable, deprecated) ### AlignedNucleotideSequence - `bases` (string, optional) - `name` (string, optional) - `pairwiseIdentity` (float, optional) — Fraction of bases between trimStart and trimEnd that match the template bases. Only present for Template Alignments; Will be empty for Consensus Alignments. - `sequenceId` (string, optional, nullable) - `trimEnd` (integer, optional) - `trimStart` (integer, optional) - `dnaSequenceId` (string, optional, nullable, deprecated) ### DnaSequence - `aliases` (list of string, optional) - `annotations` (list of DnaAnnotation, optional) - `apiURL` (string, optional) — The canonical url of the DNA Sequence in the API. - `archiveRecord` (ArchiveRecord, optional, nullable) - `authors` (list of UserSummary, optional) - `bases` (string, optional) - `createdAt` (datetime, optional) - `creator` (UserSummary, optional) - `customFields` (map from string to CustomField, optional) - `dnaAlignmentIds` (list of string, optional) — API IDs of Nucleotide Alignments involving the RNA sequence - `entityRegistryId` (string, optional, nullable) - `fields` (map from string to Field, optional) - `folderId` (string, optional, nullable) - `id` (string, optional) - `isCircular` (boolean, optional) - `length` (integer, optional) - `modifiedAt` (datetime, optional) - `name` (string, optional) - `parts` (list of DnaSequencePart, optional) - `primers` (list of Primer, optional) - `registrationOrigin` (RegistrationOrigin, optional, nullable) - `registryId` (string, optional, nullable) - `schema` (SchemaSummary, optional, nullable) - `transcriptions` (list of DnaSequenceTranscription, optional) - `translations` (list of Translation, optional) - `url` (string, optional) — The path of the web URL, omitting the tenant domain - `webURL` (string, optional) ### RnaSequence - `aliases` (list of string, optional) - `alignmentIds` (list of string, optional) — API IDs of Nucleotide Alignments involving the RNA sequence - `annotations` (list of RnaAnnotation, optional) - `apiURL` (string, optional) — The canonical url of the RNA Sequence in the API. - `archiveRecord` (ArchiveRecord, optional, nullable) - `authors` (list of UserSummary, optional) - `bases` (string, optional) - `createdAt` (datetime, optional) - `creator` (UserSummary, optional) - `customFields` (map from string to CustomField, optional) - `customNotation` (string, optional, nullable) — Representation of the RNA Sequence in the custom notation specified in the request. Null if no notation was specified. - `customNotationName` (string, optional, nullable) — Name of the custom notation specified in the request. Null if no notation was specified. - `entityRegistryId` (string, optional, nullable) - `fields` (map from string to Field, optional) - `folderId` (string, optional, nullable) - `helm` (string, optional, nullable) — Representation of the RNA Sequence in HELM syntax, including any chemical modifications. - `id` (string, optional) - `isCircular` (boolean, optional) - `length` (integer, optional) - `modifiedAt` (datetime, optional) - `name` (string, optional) - `parts` (list of RnaSequencePart, optional) - `primers` (list of Primer, optional) - `registrationOrigin` (RegistrationOrigin, optional, nullable) - `registryId` (string, optional, nullable) - `schema` (SchemaSummary, optional, nullable) - `translations` (list of Translation, optional) - `url` (string, optional) — The path of the web URL, omitting the tenant domain - `webURL` (string, optional) ### DnaOligo ### RnaOligo ### AaSequence - `aliases` (list of string, optional) — Array of aliases - `aminoAcids` (string, optional) — Amino acids of the AA sequence. - `annotations` (list of AaAnnotation, optional) — Array of annotation objects on the AA sequence. - `apiURL` (string, optional) — The canonical url of the AA Sequence in the API. - `archiveRecord` (ArchiveRecord, optional, nullable) - `authors` (list of UserSummary, optional) - `createdAt` (datetime, optional) — DateTime the AA sequence was created. - `creator` (UserSummary, optional) - `customFields` (map from string to CustomField, optional) — Custom fields set on the AA sequence. - `entityRegistryId` (string, optional, nullable) — Registry ID of the AA sequence if registered. - `fields` (map from string to Field, optional) - `folderId` (string, optional, nullable) — ID of the folder that contains the AA sequence. - `id` (string, optional) — ID of the AA sequence. - `length` (integer, optional) — Number of amino acids in the AA sequence. - `modifiedAt` (datetime, optional) — DateTime the AA sequence was last modified. - `name` (string, optional) — Name of the AA sequence. - `registrationOrigin` (RegistrationOrigin, optional, nullable) - `registryId` (string, optional, nullable) — Registry the AA sequence is registered in. - `schema` (SchemaSummary, optional, nullable) - `url` (string, optional) — The path of the web URL, omitting the tenant domain - `webURL` (string, optional) — URL of the AA sequence. ### CustomEntity - `aliases` (list of string, optional) - `apiURL` (string, optional) — The canonical url of the Custom Entity in the API. - `archiveRecord` (ArchiveRecord, optional, nullable) - `authors` (list of UserSummary, optional) - `createdAt` (datetime, optional) - `creator` (CustomEntityCreator, optional) - `customFields` (map from string to CustomField, optional) - `entityRegistryId` (string, optional, nullable) - `fields` (map from string to Field, optional) - `folderId` (string, optional, nullable) - `id` (string, optional) - `modifiedAt` (datetime, optional) - `name` (string, optional) - `registrationOrigin` (RegistrationOrigin, optional, nullable) - `registryId` (string, optional, nullable) - `schema` (SchemaSummary, optional, nullable) - `url` (string, optional) — The path of the web URL, omitting the tenant domain - `webURL` (string, optional) ### Container - `archiveRecord` (ArchiveRecord, optional, nullable) - `barcode` (string, optional, nullable) - `checkoutRecord` (CheckoutRecord, optional) — *assignee field* is set if status is "RESERVED" or "CHECKED_OUT", or null if status is "AVAILABLE". *comment field* is set when container was last reserved, checked out, or checked into. *modifiedAt field* is the date and time when container was last checked out, checked in, or reserved - `contents` (list of ContainerContent, optional) - `createdAt` (datetime, optional) - `creator` (UserSummary, optional) - `fields` (map from string to Field, optional) - `id` (string, optional) - `modifiedAt` (datetime, optional) - `name` (string, optional) - `parentStorageId` (string, optional, nullable) - `parentStorageSchema` (SchemaSummary, optional, nullable) - `projectId` (string, optional, nullable) - `quantity` (ContainerQuantity, optional) — Quantity of a container, well, or transfer. Supports mass, volume, and other quantities. - `restrictedSampleParties` (list of ContainerRestrictedSamplePartiesItems, optional) - `restrictionStatus` (enum, optional) - Allowed values: `RESTRICTED`, `UNRESTRICTED`, `NOT_APPLICABLE` - `role` (ExperimentalWellRole, optional, nullable) - `sampleOwners` (list of ContainerSampleOwnersItems, optional) - `schema` (SchemaSummary, optional, nullable) - `volume` (DeprecatedContainerVolumeForResponse, optional) — The deprecated "volume" type key in API responses can also contain non-volume quantities for back-compatibility purposes. Use the "quantity" type key instead. - `webURL` (string, optional) ### AutomationOutputProcessorAutomationFileConfig - `name` (string, optional) ### Blob - `id` (string, optional) — The universally unique identifier (UUID) for the blob. - `mimeType` (string, optional) — eg. application/jpeg - `name` (string, optional) — Name of the blob - `type` (enum, optional) — One of RAW_FILE or VISUALIZATION. If VISUALIZATION, the blob may be displayed as an image preview. - Allowed values: `RAW_FILE`, `VISUALIZATION` - `uploadStatus` (enum, optional) - Allowed values: `IN_PROGRESS`, `COMPLETE`, `ABORTED` ### ArchiveRecord - `reason` (string, optional) ### AutomationProgressStats Processing progress information. - `rowsFailed` (integer, optional) - `rowsSucceeded` (integer, optional) - `rowsUnprocessed` (integer, optional) ### LabAutomationTransform - `apiURL` (string, optional) — The canonical url of the transform in the API. - `blobId` (string, optional, nullable) - `customTransformId` (string, optional, nullable) - `errors` (LabAutomationBenchlingAppErrors, optional) - `id` (string, optional) - `inputGeneratorId` (string, optional, nullable) - `modifiedAt` (datetime, optional) — DateTime the transform was last modified. - `outputProcessorId` (string, optional, nullable) - `status` (enum, optional) - Allowed values: `NOT_STARTED`, `RUNNING`, `FAILED`, `SUCCEEDED` ### AutomationInputGeneratorAutomationFileConfig - `name` (string, optional) ### Feature A feature from a feature library - `color` (string, optional) — The color of the annotations generated by the feature. Must be a valid hex string - `featureLibraryId` (string, optional) — The id of the feature library the feature belongs to - `featureType` (string, optional, nullable) — The type of feature, like gene, promoter, etc. Note: This is an arbitrary string, not an enum - `name` (string, optional) — The name of the feature - `pattern` (string, optional) — The pattern used for matching during auto-annotation. - `id` (string, optional) — The id of the feature - `matchType` (enum, optional) — The match type of the feature. Used to determine how auto-annotate matches are made. - Allowed values: `nucleotide`, `protein` ### FindMatchingRegionsAsyncTaskResponseAaSequenceMatchesItems - `matchingAASequenceIds` (list of string, optional) - `targetAASequenceId` (string, optional) ### FindMatchingRegionsDnaAsyncTaskResponseDnaSequenceMatchesItems - `matchingDnaSequenceIds` (list of string, optional) - `targetDnaSequenceId` (string, optional) ### DnaAnnotation - `color` (string, optional) — Hex color code used when displaying this feature in the UI. - `customFields` (list of SequenceFeatureCustomField, optional) - `name` (string, optional) - `notes` (string, optional) - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) - `type` (string, optional) ### UserSummary - `handle` (string, optional) - `id` (string, optional) - `name` (string, optional) ### CustomField - `value` (string, optional) ### Field - `value` (FieldValue, required, nullable) — For single link fields, use the id of the item you want to link (eg. "seq_jdf8BV24"). For multi-link fields, use an array of ids of the items you want to link (eg. ["seq_jdf8BV24"]) - `displayValue` (string, optional, nullable) - `isMulti` (boolean, optional) - `textValue` (string, optional, nullable) - `type` (enum, optional) - Allowed values: `dna_sequence_link`, `aa_sequence_link`, `custom_entity_link`, `entity_link`, `mixture_link`, `molecule_link`, `dropdown`, `part_link`, `translation_link`, `aa_part_link`, `base_molecule_link`, `blob_link`, `text`, `long_text`, `batch_link`, `storage_link`, `entry_link`, `assay_request_link`, `assay_result_link`, `assay_run_link`, `boolean`, `float`, `integer`, `datetime`, `date`, `json` ### DnaSequencePart - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `sequenceId` (string, optional) - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) ### Primer - `bases` (string, optional) - `bindPosition` (integer, optional) - `color` (string, optional) - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `name` (string, optional) - `oligoId` (string, optional) - `overhangLength` (integer, optional) - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) ### RegistrationOrigin - `originEntryId` (string, optional, nullable) - `registeredAt` (datetime, optional) ### SchemaSummary - `id` (string, optional) - `name` (string, optional) ### DnaSequenceTranscription - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `sequenceId` (string, optional) — Linked RNA sequence ID. - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) ### Translation - `color` (string, optional) — Hex color code used when displaying this feature in the UI. - `customFields` (list of SequenceFeatureCustomField, optional) - `name` (string, optional) - `notes` (string, optional) - `aminoAcids` (string, optional) - `coerceStartCodonToMethionine` (boolean, optional, default: false) — Whether to override the translation of the start codon to Methionine. Has no effect when the start codon already translates to Methionine. - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `geneticCode` (enum, optional, default: STANDARD) — The genetic code to use when translating the nucleotide sequence into amino acids. - Allowed values: `STANDARD`, `VERTEBRATE_MITOCHONDRIAL`, `YEAST_MITOCHONDRIAL`, `MOLD_PROTOZOAN_COELENTERATE_MITOCHONDRIAL_MYCOPLASMA_SPIROPLASMA`, `INVERTEBRATE_MITOCHONDRIAL`, `CILIATE_DASYCLADACEAN_HEXAMITA_NUCLEAR`, `ECHINODERM_FLATWORM_MITOCHONDRIAL`, `EUPLOTID_NUCLEAR`, `BACTERIAL_ARCHAEAL_PLANT_PLASTID`, `ALTERNATIVE_YEAST_NUCLEAR`, `ASCIDIAN_MITOCHONDRIAL`, `ALTERNATIVE_FLATWORM_MITOCHONDRIAL`, `CHLOROPHYCEAN_MITOCHONDRIAL`, `TREMATODE_MITOCHONDRIAL`, `SCENEDESMUS_OBLIQUUS_MITOCHONDRIAL`, `THRAUSTOCHYTRIUM_MITOCHONDRIAL`, `RHABDOPLEURIDAE_MITOCHONDRIAL`, `CANDIDATE_DIVISION_SR1_GRACILIBACTERIA`, `PACHYSOLEN_TANNOPHILUS_NUCLEAR`, `MESODINIUM_NUCLEAR`, `PERITRICH_NUCLEAR`, `CEPHALODISCIDAE_MITOCHONDRIAL_UAA_TYR` - `regions` (list of TranslationRegionsItems, optional) - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) ### RnaAnnotation - `color` (string, optional) — Hex color code used when displaying this feature in the UI. - `customFields` (list of SequenceFeatureCustomField, optional) - `name` (string, optional) - `notes` (string, optional) - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) - `type` (string, optional) ### RnaSequencePart - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `sequenceId` (string, optional) - `start` (integer, optional) — 0-based inclusive start index. - `strand` (integer, optional) ### AaAnnotation - `color` (string, optional) - `end` (integer, optional) — 0-based exclusive end index. The end of the AA sequence is always represented as 0. - `id` (string, optional) - `name` (string, optional) - `notes` (string, optional) - `start` (integer, optional) — 0-based inclusive start index. - `type` (string, optional) ### CustomEntityCreator - `handle` (string, optional) - `id` (string, optional) - `name` (string, optional) ### CheckoutRecord *assignee field* is set if status is "RESERVED" or "CHECKED_OUT", or null if status is "AVAILABLE". *comment field* is set when container was last reserved, checked out, or checked into. *modifiedAt field* is the date and time when container was last checked out, checked in, or reserved - `assignee` (CheckoutRecordAssignee, optional, nullable) - `comment` (string, optional) - `modifiedAt` (datetime, optional) - `status` (enum, optional) - Allowed values: `AVAILABLE`, `RESERVED`, `CHECKED_OUT` ### ContainerContent - `batch` (BatchOrInaccessibleResource, optional, nullable) - `concentration` (Measurement, optional) - `entity` (EntityOrInaccessibleResource, optional, nullable) ### ContainerQuantity Quantity of a container, well, or transfer. Supports mass, volume, and other quantities. - `units` (enum, optional, nullable) - Allowed values: `L`, `mL`, `uL`, `nL`, `pL`, `gal (US)`, `qt (US)`, `pt (US)`, `kg`, `g`, `mg`, `ug`, `ng`, `pg`, `lb`, `oz`, `mol`, `mmol`, `umol`, `nmol`, `pmol`, `cells`, `(x10^3) cells`, `(x10^4) cells`, `(x10^5) cells`, `(x10^6) cells`, `(x10^7) cells`, `(x10^8) cells`, `(x10^9) cells`, `items`, `units` - `value` (double, optional, nullable) ### ContainerRestrictedSamplePartiesItems ### ExperimentalWellRole - `group` (integer, optional) - `primaryRole` (enum, optional) - Allowed values: `SAMPLE`, `CONTROL`, `STANDARD`, `BLANK` - `subrole` (string, optional, nullable) ### ContainerSampleOwnersItems ### DeprecatedContainerVolumeForResponse The deprecated "volume" type key in API responses can also contain non-volume quantities for back-compatibility purposes. Use the "quantity" type key instead. - `units` (enum, optional, nullable) - Allowed values: `L`, `mL`, `uL`, `nL`, `pL`, `gal (US)`, `qt (US)`, `pt (US)`, `kg`, `g`, `mg`, `ug`, `ng`, `pg`, `lb`, `oz`, `mol`, `mmol`, `umol`, `nmol`, `pmol`, `cells`, `(x10^3) cells`, `(x10^4) cells`, `(x10^5) cells`, `(x10^6) cells`, `(x10^7) cells`, `(x10^8) cells`, `(x10^9) cells`, `items`, `units` - `value` (double, optional, nullable) ### LabAutomationBenchlingAppErrors - `topLevelErrors` (list of LabAutomationBenchlingAppErrorsTopLevelErrorsItems, optional) ### SequenceFeatureCustomField A name and value pair associated with a sequence feature (annotation or translation). For genbank imports, these are the qualifiers associated with each feature. - `name` (string, optional) — Name of the custom field - `value` (string, optional) — Value of the custom field ### FieldValue For single link fields, use the id of the item you want to link (eg. "seq_jdf8BV24"). For multi-link fields, use an array of ids of the items you want to link (eg. ["seq_jdf8BV24"]) ### TranslationRegionsItems - `end` (integer, optional) — 0-based exclusive end index. The end of the sequence is always represented as 0. - `start` (integer, optional) — 0-based inclusive start index. ### CheckoutRecordAssignee ### BatchOrInaccessibleResource ### Measurement - `units` (string, required, nullable) — Can only be null if value is also null - `value` (double, required, nullable) — Can only be null if units is also null ### EntityOrInaccessibleResource ### TeamSummary - `id` (string, optional) - `name` (string, optional) ### LabAutomationBenchlingAppErrorsTopLevelErrorsItems - `errorMessage` (string, optional) ### Batch - `archiveRecord` (ArchiveRecord, optional, nullable) - `createdAt` (datetime, optional) — DateTime at which the the result was created - `creator` (UserSummary, optional) - `defaultConcentration` (Measurement, optional) - `entity` (BatchEntity, optional) - `fields` (map from string to Field, optional) - `id` (string, optional) - `modifiedAt` (datetime, optional) - `name` (string, optional) - `schema` (SchemaSummary, optional, nullable) - `webURL` (string, optional) ### InaccessibleResource - `inaccessibleId` (string, optional) - `type` (string, optional) — The type of this inaccessible item. Example values: "custom_entity", "container", "plate", "dna_sequence" ### BatchEntity - `entityType`: `aa_sequence` (aa_sequence) - `id` (string, optional) - `type` (string, optional, deprecated) - `entityType`: `custom_entity` (custom_entity) - `id` (string, optional) - `type` (string, optional, deprecated) - `entityType`: `dna_sequence` (dna_sequence) - `id` (string, optional) - `type` (string, optional, deprecated) ## Examples ### AA Sequences - Bulk Create **Response** ```json { "response": { "aaSequences": [ { "aliases": [ "Example alias" ], "aminoAcids": "IKTATARRELAETSWTGDRLWGFSDNWAPALRRPSPSALGK", "annotations": [ { "color": "#85DAE9", "end": 10, "id": "prtnann_o7zMPG0P", "name": "Example annotation", "start": 0 } ], "apiURL": "https://benchling.com/api/v2/aa-sequences/prtn_7nMBOMm0", "archiveRecord": { "reason": "Made in error" }, "createdAt": "2021-07-14T07:34:25.156Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "prtn_ObbdtGhC", "length": 0, "modifiedAt": "2021-07-14T07:34:25.157Z", "name": "Example AA Sequence", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_55UxcIps-registry/prtn_7nMBOMm0-kedchain11/edit\"" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python AA Sequences - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript AA Sequences - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### AA Sequences - Bulk Update **Response** ```json { "response": { "aaSequences": [ { "aliases": [ "Example alias" ], "aminoAcids": "IKTATARRELAETSWTGDRLWGFSDNWAPALRRPSPSALGK", "annotations": [ { "color": "#85DAE9", "end": 10, "id": "prtnann_o7zMPG0P", "name": "Example annotation", "start": 0 } ], "apiURL": "https://benchling.com/api/v2/aa-sequences/prtn_7nMBOMm0", "archiveRecord": { "reason": "Made in error" }, "createdAt": "2021-07-14T07:34:25.156Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "prtn_ObbdtGhC", "length": 0, "modifiedAt": "2021-07-14T07:34:25.157Z", "name": "Example AA Sequence", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_55UxcIps-registry/prtn_7nMBOMm0-kedchain11/edit\"" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python AA Sequences - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript AA Sequences - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### AA Sequences - Find Matching Region **Response** ```json { "response": { "aaSequenceMatches": [ { "matchingAASequenceIds": [ "prtn_TIIi7lto", "prtn_0qTaIIDE" ], "targetAASequenceId": "prtn_W1Qh8teE" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python AA Sequences - Find Matching Region import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript AA Sequences - Find Matching Region const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Audit - Export Audit Log **Response** ```json { "response": { "downloadURL": "https://benchling-temp.s3.amazonaws.com/exports/dHJgG40awwbze7a6jhaoShaqwGGpgyb1atUD4f16/entry_audit_log_etr_Fr35NTqk_doe_04Dec2024.csv?response-content-disposition=attachment&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=ASIASZPD3ICD3FJP5KAL%2F20241204%2Fus-west-2%2Fs3%2Faws4_request&X-Amz-Date=20241204T194928Z&X-Amz-Expires=86400&X-Amz-SignedHeaders=host&X-Amz-Security-Token=IQo...&X-Amz-Signature=5ce237d862201e1bba540fac126852f4b1568cfa829d59618c80370a4fa58931" }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Audit - Export Audit Log import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Audit - Export Audit Log const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Containers - Bulk Create **Response** ```json { "response": { "containers": [ { "archiveRecord": { "reason": "Made in error" }, "barcode": "201006-005", "checkoutRecord": { "assignee": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "comment": "Example comment", "modifiedAt": "2021-07-14T12:27:27.917Z", "status": "AVAILABLE" }, "contents": [ { "batch": { "archiveRecord": { "reason": "Made in error" }, "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "entity": { "aliases": [ "Example alias" ], "annotations": [], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_hBHqKbzE", "id": "seq_bhuDUw9D", "isCircular": true, "length": 0, "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example entity", "primers": [], "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "translations": [], "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit" }, "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "id": "bat_UOIr8IjL", "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example Batch", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_55UxcIps-registry/bfi_YtegMKkT-batch-test/edit" }, "concentration": { "units": "uM", "value": 5 }, "entity": { "aliases": [ "Example alias" ], "annotations": [], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "isCircular": true, "length": 0, "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example entity", "primers": [], "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "translations": [], "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit" } } ], "createdAt\"": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "id": "con_ZBL9QQWD", "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example container", "parentStorageId": "loc_MmtNUQIA", "parentStorageSchema": { "id": "locsch_ToRk7Elm", "name": "Building" }, "projectId": "src_1m4443Ek", "quantity": { "units": "mL", "value": 10 }, "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "volume": { "units": "mL", "value": 10 }, "webURL": "https://benchling.com/samples/containers/con_FzQ1stz9" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Containers - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Containers - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Containers - Bulk Update **Response** ```json { "response": { "containers": [ { "archiveRecord": { "reason": "Made in error" }, "barcode": "201006-005", "checkoutRecord": { "assignee": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "comment": "Example comment", "modifiedAt": "2021-07-14T12:27:27.917Z", "status": "AVAILABLE" }, "contents": [ { "batch": { "archiveRecord": { "reason": "Made in error" }, "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "entity": { "aliases": [ "Example alias" ], "annotations": [], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_hBHqKbzE", "id": "seq_bhuDUw9D", "isCircular": true, "length": 0, "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example entity", "primers": [], "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "translations": [], "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit" }, "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "id": "bat_UOIr8IjL", "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example Batch", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_55UxcIps-registry/bfi_YtegMKkT-batch-test/edit" }, "concentration": { "units": "uM", "value": 5 }, "entity": { "aliases": [ "Example alias" ], "annotations": [], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "isCircular": true, "length": 0, "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example entity", "primers": [], "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "translations": [], "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit" } } ], "createdAt\"": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "id": "con_ZBL9QQWD", "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example container", "parentStorageId": "loc_MmtNUQIA", "parentStorageSchema": { "id": "locsch_ToRk7Elm", "name": "Building" }, "projectId": "src_1m4443Ek", "quantity": { "units": "mL", "value": 10 }, "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "volume": { "units": "mL", "value": 10 }, "webURL": "https://benchling.com/samples/containers/con_FzQ1stz9" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Containers - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Containers - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Containers - Transfers **Response** ```json { "response": { "destinationContainers": [ { "archiveRecord": { "reason": "Made in error" }, "barcode": "201006-005", "checkoutRecord": { "assignee": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "comment": "Example comment", "modifiedAt": "2021-07-14T12:27:27.917Z", "status": "AVAILABLE" }, "contents": [ { "batch": { "archiveRecord": { "reason": "Made in error" }, "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "entity": { "aliases": [ "Example alias" ], "annotations": [], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_hBHqKbzE", "id": "seq_bhuDUw9D", "isCircular": true, "length": 0, "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example entity", "primers": [], "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "translations": [], "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit" }, "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "id": "bat_UOIr8IjL", "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example Batch", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_55UxcIps-registry/bfi_YtegMKkT-batch-test/edit" }, "concentration": { "units": "uM", "value": 5 }, "entity": { "aliases": [ "Example alias" ], "annotations": [], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "isCircular": true, "length": 0, "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example entity", "primers": [], "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "translations": [], "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit" } } ], "createdAt\"": "2021-07-14T12:27:27.917Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "id": "con_ZBL9QQWD", "modifiedAt": "2021-07-14T12:27:27.917Z", "name": "Example container", "parentStorageId": "loc_MmtNUQIA", "parentStorageSchema": { "id": "locsch_ToRk7Elm", "name": "Building" }, "projectId": "src_1m4443Ek", "quantity": { "units": "mL", "value": 10 }, "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "volume": { "units": "mL", "value": 10 }, "webURL": "https://benchling.com/samples/containers/con_FzQ1stz9" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Containers - Transfers import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Containers - Transfers const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Custom Entities - Bulk Create **Response** ```json { "response": { "customEntities": [ { "aliases": [ "sBN000" ], "apiURL": "https://benchling.com/api/v2/custom-entities/bfi_xCUXNVyG", "archiveRecord": { "reason": "Made in error" }, "authors": [ { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" } ], "createdAt": "2021-07-14T07:34:25.156Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "prtn_ObbdtGhC", "modifiedAt": "2021-07-14T07:34:25.157Z", "name": "sBN000", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/R8KcsjhW-academic-registry/bfi-xCUXNVyG-sbn000/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Custom Entities - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Custom Entities - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Custom Entities - Bulk Update **Response** ```json { "response": { "customEntities": [ { "aliases": [ "sBN000" ], "apiURL": "https://benchling.com/api/v2/custom-entities/bfi_xCUXNVyG", "archiveRecord": { "reason": "Made in error" }, "authors": [ { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" } ], "createdAt": "2021-07-14T07:34:25.156Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "prtn_ObbdtGhC", "modifiedAt": "2021-07-14T07:34:25.157Z", "name": "sBN000", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-14T07:34:25.157Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/R8KcsjhW-academic-registry/bfi-xCUXNVyG-sbn000/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Custom Entities - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Custom Entities - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Alignments - Create Consensus Alignment **Response** ```json { "response": { "alignedSequences": [ { "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "dnaSequenceId": "seq_MYmsnS1u", "name": "Gene001", "sequenceId": "seq_MYmsnS1u", "trimEnd": 60, "trimStart": 0 } ], "apiURL": "https://benchling.com/api/v2/dna-alignments/seqanl_6ZVdX98t", "createdAt": "2021-07-13T12:59:51.903Z", "id": "seqanl_6ZVdX98t", "modifiedAt": "2021-07-13T12:59:51.903Z", "name": "Example alignment", "webURL": "https://benchling.com/benchling/f/lib_Fy2C0HOl-example/seq_UpzwvUug-consensus/edit?alignment=seqanl_6ZVdX98t" }, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Alignments - Create Consensus Alignment import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Alignments - Create Consensus Alignment const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Alignments - Create Template Alignment **Response** ```json { "response": { "alignedSequences": [ { "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "dnaSequenceId": "seq_MYmsnS1u", "name": "Gene001", "sequenceId": "seq_MYmsnS1u", "trimEnd": 60, "trimStart": 0 } ], "apiURL": "https://benchling.com/api/v2/dna-alignments/seqanl_6ZVdX98t", "createdAt": "2021-07-13T12:59:51.903Z", "id": "seqanl_6ZVdX98t", "modifiedAt": "2021-07-13T12:59:51.903Z", "name": "Example alignment", "webURL": "https://benchling.com/benchling/f/lib_Fy2C0HOl-example/seq_UpzwvUug-consensus/edit?alignment=seqanl_6ZVdX98t" }, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Alignments - Create Template Alignment import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Alignments - Create Template Alignment const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Oligos - Bulk Create **Response** ```json { "response": { "dnaOligos": [ { "aliases": [ "Example alias" ], "apiURL": "https://benchling.com/api/v2/dna-oligos/seq_bhuDUw9D", "archiveRecord": { "reason": "Made in error" }, "bases": "ACTTTTT", "createdAt": "2021-07-13T21:00:49.245Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "length": 0, "modifiedAt": "2021-07-13T21:00:49.245Z", "name": "Example DNA Oligo", "nucleotideType": "DNA", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-13T21:00:49.245Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Oligos - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Oligos - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Oligos - Bulk Update **Response** ```json { "response": { "dnaOligos": [ { "aliases": [ "Example alias" ], "apiURL": "https://benchling.com/api/v2/dna-oligos/seq_bhuDUw9D", "archiveRecord": { "reason": "Made in error" }, "bases": "ACTTTTT", "createdAt": "2021-07-13T21:00:49.245Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "length": 0, "modifiedAt": "2021-07-13T21:00:49.245Z", "name": "Example DNA Oligo", "nucleotideType": "DNA", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-13T21:00:49.245Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Oligos - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Oligos - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Sequences - Auto Annotate **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Sequences - Auto Annotate import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Sequences - Auto Annotate const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Sequences - Autofill Parts **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Sequences - Autofill Parts import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Sequences - Autofill Parts const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Sequences - Autofill Transcriptions **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Sequences - Autofill Transcriptions import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Sequences - Autofill Transcriptions const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Sequences - Autofill Translations **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Sequences - Autofill Translations import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Sequences - Autofill Translations const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Sequences - Bulk Create **Response** ```json { "response": { "dnaSequences": [ { "aliases": [ "Example alias" ], "annotations": [ { "color": "#85DAE9", "end": 10, "name": "Example annotation", "start": 0, "strand": 0, "type": "Example annotation type" } ], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-13T13:16:44.315Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": [ { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } } ], "folderId": "lib_mrZWMrft", "id": "seq_asQya4lk", "isCircular": true, "length": 0, "modifiedAt": "2021-07-13T13:16:44.315Z", "name": "Example sequence", "primers": [ { "bases": "CATCG", "bindPosition": 0, "color": "#F58A5E", "end": 5, "name": "Example primer", "oligoId": "seq_HJyE332n", "overhangLength": 0, "start": 0, "strand": -1 } ], "registrationOrigin": { "originEntryId": "ent_a0SApq3z", "registeredAt": "2021-07-13T13:16:44.315Z" }, "registryId": "src_ae40j3TZ", "schema": { "id": "ts_n4l12nf0", "name": "Example schema" }, "translations": [ { "aminoAcids": "KK", "end": 0, "regions": [ { "end": 0, "start": 0 } ], "start": 0, "strand": 1 } ], "webURL": "https://benchling.com/benchling/f/lib_zky83cLg-computed-fields/seq_mnY8u4bs-chain-1/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Sequences - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Sequences - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### DNA Sequences - Bulk Update **Response** ```json { "response": { "dnaSequences": [ { "aliases": [ "Example alias" ], "annotations": [ { "color": "#85DAE9", "end": 10, "name": "Example annotation", "start": 0, "strand": 0, "type": "Example annotation type" } ], "apiURL": "https://benchling.com/api/v2/dna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG", "createdAt": "2021-07-13T13:16:44.315Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": [ { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } } ], "folderId": "lib_mrZWMrft", "id": "seq_asQya4lk", "isCircular": true, "length": 0, "modifiedAt": "2021-07-13T13:16:44.315Z", "name": "Example sequence", "primers": [ { "bases": "CATCG", "bindPosition": 0, "color": "#F58A5E", "end": 5, "name": "Example primer", "oligoId": "seq_HJyE332n", "overhangLength": 0, "start": 0, "strand": -1 } ], "registrationOrigin": { "originEntryId": "ent_a0SApq3z", "registeredAt": "2021-07-13T13:16:44.315Z" }, "registryId": "src_ae40j3TZ", "schema": { "id": "ts_n4l12nf0", "name": "Example schema" }, "translations": [ { "aminoAcids": "KK", "end": 0, "regions": [ { "end": 0, "start": 0 } ], "start": 0, "strand": 1 } ], "webURL": "https://benchling.com/benchling/f/lib_zky83cLg-computed-fields/seq_mnY8u4bs-chain-1/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python DNA Sequences - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript DNA Sequences - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Exports - Export Item **Response** ```json { "response": { "downloadURL": "https://benchling-temp.s3.amazonaws.com/benchling-temp/RShkPPS0dj1jsn1LKnbpl7mz421kne52Ndp8UJnB/capillary/export_items/etr_HzOyiNj8.zip?response-content-disposition=attachment&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=ASIAVNBDYFYCFXORLN46%2F20210714%2Fus-east-1%2Fs3%2Faws4_request&X-Amz-Date=20210714T144850Z&X-Amz-Expires=86400&X-Amz-SignedHeaders=host&X-Amz-Security-Token=IQoJb3JpZ2luX2VjEB4aCXVzLWVhc3QtMSJSDNU1IHZ81FpESNaiQLue6l%2Bjz04FWk7fNUhMxiEbLYCt5LDNAiEAhNbTM9EdeAuxlj4svhS01NmwRJZTyF3Bjzr%2BhK22ACcq%2BQMIFxAAGrebNzE1ODk2NTYwNjgiDHKa3fq33iZwsM1KdCrWA8dnOWQ1%2FXsYrrbzk7cCID6qPA%2F3MQH%2F7FaQoMCUvXj06aeH6RhMD5WZyqoaISBr%2FP4FUua%2B%2FFSdAW8UoFpur0IvkSFTi472CA7hfGmgcjspBdsTCrOA8R1ofgscYwOvGcFreenw5l1VhXZDSeXLC9yLJXPBWFzeup8uRyNXQFIHFcmNHvsLiLMUTY0S5eEBc5Zn9SAaWOcm4OGjAurpUJqpTTPOAu5VZOT2d1K2XMy%2FoH7x01Xf0MRIEd0yfyOLK60dhngbaey39vw1wMfPOm3JBvOyVdhGg1WR2sRF1RG10t7dI7iIO2Y4Z3Yb9w%2FdQhlafF8Ss45YtRRv2RRtzfpwoWE846At1pWvhP0tA0I1bhtehd6Upk%2F0iLehO5JWUiYqz1oMfefdZa30JAS9UNdKNqqsX8%2FjhAR9Ff09xKzOD%2FXzqeZwTT0EWtG6hqerKX9%2B%2BULfjB%2F44t3FjL5pRXrxRDIy0uZVI3qhjoRot5Nf7Lm9edccJJ%2BaujnHOMd96mxEcB584VO6eb63I99geVmNO%2FGpuuBvMxf2oV4AN83BEKipJEM3K4OYFI5VASfcTx2V3nMILj8FMKATYEWPYns0KxMuEpQ0Nf7dSSEiFKIfQ1px5iEvMKfPu4cGOqUBUaO0C2gNEeOUs8Fy4ci2hsLw4MW7jVnT5jLEQd2BB44hZzqkMvmeOYeiTxQB%2FgBpqAC%2FfZRF2Am3nCyLaADQYGpRhpg0QFRkBH8ukSxqOx%2BwLvLAV537t5AfFLcqjar4C9a0DXO9hgWfF3yY6HISlZ4NE9VGXei1wqy7i5ZDcbP1%2FlfWqH6LspK2rMJGgAlJthf7De%2BlQ5yJmYW%2FH7KG5eC%2Fu2MV&X-Amz-Signature=b08cad199962bcdc6d0b4b5d2409e90b67a4484ae554ce843f537d1d471ea70d" }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Exports - Export Item import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Exports - Export Item const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Features - Bulk Create **Response** ```json { "response": { "features": [ { "color": "#75C6A9", "featureLibraryId": "featlib_cWYhFmxq", "featureType": "promoter", "id": "feat_XhYjGBpFoZ4wVary", "matchType": "nucleotide", "name": "lacZalpha promoter", "pattern": "ggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccga" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Features - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Features - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Lab Automation - Generate Input **Response** ```json { "response": { "apiURL": "https://benchling.com/api/v2/automation-input-generators/aif_C3wGA9HF", "assayRunId": "588aca02-1a20-4b94-a40f-b3f3a0081749", "automationFileConfig": { "name": "MyInstrumentName" }, "file": { "id": "c33fe52d-fe6a-4c98-adcd-211bdf6778f7", "mimeType": "text/csv", "name": "MyInstrumentInputFile.csv", "type": "RAW_FILE", "uploadStatus": "IN_PROGRESS" }, "id": "aif_C3wGA9HF", "status": "SUCCEEDED" }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Lab Automation - Generate Input import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Lab Automation - Generate Input const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Lab Automation - Process Output **Response** ```json { "response": { "apiURL": "https://benchling.com/api/v2/automation-output-processors/aop_C3wGA9HF", "archiveRecord": { "reason": "Made in error" }, "assayRunId": "588aca02-1a20-4b94-a40f-b3f3a0081749", "automationFileConfig": { "name": "MyInstrumentName" }, "file": { "id": "c33fe52d-fe6a-4c98-adcd-211bdf6778f7", "mimeType": "text/csv", "name": "MyInstrumentInputFile.csv", "type": "RAW_FILE", "uploadStatus": "IN_PROGRESS" }, "id": "aop_C3wGA9HF", "status": "SUCCEEDED" }, "status": "SUCCEEDED" } ``` **SDK Code** ```python Lab Automation - Process Output import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Lab Automation - Process Output const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Oligos - Bulk Create **Response** ```json { "response": { "rnaOligos": [ { "aliases": [ "Example alias" ], "apiURL": "https://benchling.com/api/v2/rna-oligos/seq_bhuDUw9", "archiveRecord": { "reason": "Made in error" }, "bases": "ACUUUUU", "createdAt": "2021-07-13T21:00:49.245Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "length": 0, "modifiedAt": "2021-07-13T21:00:49.245Z", "name": "Example RNA Oligo", "nucleotideType": "DNA", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-13T21:00:49.245Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Oligos - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Oligos - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Oligos - Bulk Update **Response** ```json { "response": { "rnaOligos": [ { "aliases": [ "Example alias" ], "apiURL": "https://benchling.com/api/v2/rna-oligos/seq_bhuDUw9", "archiveRecord": { "reason": "Made in error" }, "bases": "ACUUUUU", "createdAt": "2021-07-13T21:00:49.245Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "dna_sequence_link", "value": [ "seq_jdf8BV24" ] } }, "folderId": "lib_mrZWMrft", "id": "seq_bhuDUw9D", "length": 0, "modifiedAt": "2021-07-13T21:00:49.245Z", "name": "Example RNA Oligo", "nucleotideType": "DNA", "registrationOrigin": { "originEntryId": "etr_3wievUIJ", "registeredAt": "2021-07-13T21:00:49.245Z" }, "registryId": "src_NetYd96a", "schema": { "id": "ts_DaiFhsNA", "name": "Example Schema" }, "webURL": "https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Oligos - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Oligos - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Sequences - Auto Annotate **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Sequences - Auto Annotate import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Sequences - Auto Annotate const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Sequences - Autofill Parts **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Sequences - Autofill Parts import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Sequences - Autofill Parts const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Sequences - Autofill Translations **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Sequences - Autofill Translations import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Sequences - Autofill Translations const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Sequences - Bulk Create **Response** ```json { "response": { "rnaSequences": [ { "aliases": [ "Example alias" ], "annotations": [ { "color": "#85DAE9", "end": 10, "name": "Example annotation", "start": 0, "strand": 0, "type": "Example annotation type" } ], "apiURL": "https://benchling.com/api/v2/rna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GUAGCAAAGANUAGUAGCCAGCUGUGAUAAAUGUCAGCUAAAAGGGGAAGCCAUG", "createdAt": "2021-07-13T13:16:44.315Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": [ { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "rna_sequence_link", "value": "seq_jdf8BV24" } } ], "folderId": "lib_mrZWMrft", "id": "seq_asQya4lk", "isCircular": false, "length": 55, "modifiedAt": "2021-07-13T13:16:44.315Z", "name": "Example rna sequence", "primers": [ { "bases": "CAUCG", "bindPosition": 0, "color": "#F58A5E", "end": 5, "name": "Example primer", "oligoId": "seq_HJyE332n", "overhangLength": 0, "start": 0, "strand": 1 } ], "registrationOrigin": { "originEntryId": "ent_a0SApq3z", "registeredAt": "2021-07-13T13:16:44.315Z" }, "registryId": "src_ae40j3TZ", "schema": { "id": "ts_n4l12nf0", "name": "Example schema" }, "translations": [ { "aminoAcids": "KK", "end": 0, "regions": [ { "end": 0, "start": 0 } ], "start": 0, "strand": 1 } ], "webURL": "https://benchling.com/benchling/f/lib_zky83cLg-example/seq_mnY8u4bs-chain-1/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Sequences - Bulk Create import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Sequences - Bulk Create const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### RNA Sequences - Bulk Update **Response** ```json { "response": { "rnaSequences": [ { "aliases": [ "Example alias" ], "annotations": [ { "color": "#85DAE9", "end": 10, "name": "Example annotation", "start": 0, "strand": 0, "type": "Example annotation type" } ], "apiURL": "https://benchling.com/api/v2/rna-sequences/seq_asQya4lk", "archiveRecord": { "reason": "Made in error" }, "bases": "GUAGCAAAGANUAGUAGCCAGCUGUGAUAAAUGUCAGCUAAAAGGGGAAGCCAUG", "createdAt": "2021-07-13T13:16:44.315Z", "creator": { "handle": "lpasteur", "id": "ent_a0SApq3z", "name": "Louis Pasteur" }, "customFields": { "Legacy ID": { "value": "STR100" } }, "entityRegistryId": "sBN000", "fields": [ { "additionalProp1": { "displayValue": "Amp", "isMulti": true, "textValue": "Amp", "type": "rna_sequence_link", "value": "seq_jdf8BV24" } } ], "folderId": "lib_mrZWMrft", "id": "seq_asQya4lk", "isCircular": false, "length": 55, "modifiedAt": "2021-07-13T13:16:44.315Z", "name": "Example rna sequence", "primers": [ { "bases": "CAUCG", "bindPosition": 0, "color": "#F58A5E", "end": 5, "name": "Example primer", "oligoId": "seq_HJyE332n", "overhangLength": 0, "start": 0, "strand": 1 } ], "registrationOrigin": { "originEntryId": "ent_a0SApq3z", "registeredAt": "2021-07-13T13:16:44.315Z" }, "registryId": "src_ae40j3TZ", "schema": { "id": "ts_n4l12nf0", "name": "Example schema" }, "translations": [ { "aminoAcids": "KK", "end": 0, "regions": [ { "end": 0, "start": 0 } ], "start": 0, "strand": 1 } ], "webURL": "https://benchling.com/benchling/f/lib_zky83cLg-example/seq_mnY8u4bs-chain-1/edit" } ] }, "status": "SUCCEEDED" } ``` **SDK Code** ```python RNA Sequences - Bulk Update import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript RNA Sequences - Bulk Update const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Registry - Bulk Register Entities **Response** ```json { "response": {}, "status": "SUCCEEDED" } ``` **SDK Code** ```python Registry - Bulk Register Entities import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Registry - Bulk Register Entities const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Task Failed **Response** ```json { "message": "Alignment not found.", "status": "FAILED" } ``` **SDK Code** ```python Task Failed import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Task Failed const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Task Failed (Bulk) **Response** ```json { "errors": [ { "index": 0, "message": "Invalid field value" } ], "message": "Your request was invalid.", "status": "FAILED" } ``` **SDK Code** ```python Task Failed (Bulk) import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Task Failed (Bulk) const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ``` ### Task Running **Response** ```json { "status": "RUNNING" } ``` **SDK Code** ```python Task Running import requests url = "https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242" headers = {"Authorization": "Bearer "} response = requests.get(url, headers=headers) print(response.json()) ``` ```javascript Task Running const url = 'https://{tenant_name}.benchling.com/api/v2/tasks/f438d656-c2c3-40a4-b3fd-d7e58db78242'; const options = {method: 'GET', headers: {Authorization: 'Bearer '}}; try { const response = await fetch(url, options); const data = await response.json(); console.log(data); } catch (error) { console.error(error); } ```