Warehouse Table Columns
Note that this page doesn't display tables as well as we'd hope. Please zoom in your browser with CTRL-+ or CMD-+.
The Benchling Warehouse Columns Descriptions
Each Benchling Warehouse (WH) table has many columns that represent the data contained in each table. Use the following information help understand how each table can be used to directly query the data you have stored in Benchling.
To see all Benchling Tables in diagram format please navigate to https://docs.benchling.com/docs/warehouse-tables-v2
The following information is outlined below for every WH table:
- Column Name
- Column Definition
- Value Type
- Example Values
- Useful Notes
Tables vs.$rawtablesAs discussed in Warehouse Tables, these tables are Postgres views that represent a "cleaned up" version of the raw data. For applicable tables, we've specified the filter(s) being applied to the raw data in order to produce the cleaned table. These filters are described here:
Filter key Filter description IS_NOT_ARCHIVEDFilters away rows where the archived$column isTrueLINKED_FIELD_IS_NOT_ARCHIVEDFilters away rows in the field table where the corresponding row in the field_definition table's archived$column isTrue. This look up is an outer join onfield.field_definition_id = field_definition.idSTATIC_IS_REVIEWEDPerforms a join between the entry$rawtable and the result table (result.entry_id = entry.id). Filters away rows whose corresponding entry IS NOT accepted (entry$raw.review_status != ACCEPTED)STATIC_IS_VALIDFilters away result rows where validation_statusIS NOT NULL AND the value is notVALIDorPARTIALLY_VALID.
--{Notebook Tables}--
See below for all tables relating to the Benchling Notebook
entry
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Primary key for a Warehouse table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Format dependent on table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
display _ id | Unique identifier surfaced in the actual Benchling site | prefix - unique entry number | EXP001 or EXP20000416 | I . E Unique Entry number |
folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ J3tmt8BP | If object not in folder, then folder _ id = project _ id . If null, then object not in folder/project |
workflow _ id | Unique identifier for workflow containing object | Foreign key for workflow . id | wfw _ DMcZhu4A | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
review _ status | Current review status for object | null, NEEDS _ REVIEW, NEEDS _ REVISION, REJECTED, ACCEPTED | null, NEEDS _ REVIEW, NEEDS _ REVISION, REJECTED, ACCEPTED | |
review _ requested _ at | Date of most recent review requested for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | Date of most recent review request |
review _ status _ changed _ at | Date of review status change for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| url | url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX |
entry_auditor
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | See User Table for more information |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | See Entry Table for more information |
author
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | See User Table for more information |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | If entry has multiple authors there will be multiple rows per entry_id. See Entry Table for more information |
--{Lab Automation Tables}--
EXAMPLE Lab Auto table
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | identifier of the run | Character varying | ee6da040-fa64-4e47-9a5e-98892fa32580 | |
| source_id | project that the run is in | Character varying | src_RWL0Oekn | |
| schema | lab auto schema this run is part of | Character varying | transfection_v1_schema | |
| created_at$ | when the run was created | timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| creator_id$ | who created it | Character varying | ent_naLWig4C | |
| entry_id$ | which entry it was created in | Character varying | etr_nLrUvmPx | |
| archived$ | whether the run was archived | boolean | false | |
| archive_purpose$ | reason for why the run was archived, if archived | Character varying | null | |
| validation_status$ | validation status | Character varying | VALID | |
| validation_comment$ | validation information | Character varying | null | |
| plate | custom created columns as part of the run configuration | Character varying | "plt_2Q09VfYn" |
--{Results Tables}--
assay_run_schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
parent _ schema _ id | Unique identifier for schema which object is derived from | Foreign key for schema . id | ts _ XDQ0OW6s |
assay_result_schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
parent _ schema _ id | Unique identifier for schema which object is derived from | Foreign key for schema . id | ts _ XDQ0OW6s |
EXAMPLE Result table
Applied filter(s): IS_NOT_ARCHIVED, STATIC_IS_REVIEWED, STATIC_IS_VALID
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema | Unique Schema name for object | Text | "Fermentation Results" | |
created _ at$ | Date created for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| custom$ | Any custom created columns will be shown here | JSONB | { } | Custom Columns are created after a result table has been entered into a Notebook entry |
| entity | The Entity an object is mapped to | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
entry _ id$ | Unique identifier for Entry | Foreign key for entry . id | etr _ GtcscEZq | See Entry Table for more information |
run _ id$ | Unique identifier for Entry | Foreign key for run . id | a11d82b2 - 8df3 - 44ae - bb2e - 89086c8b69a4 | See Entry Table for more information |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
validation _ status$ | Validation status for individual result object | VALID, INVALID | VALID, INVALID | |
validation _ comment$ | Validation comment for individual result object | Text | "Standard curve failure" | |
field _ validation$ | Validation comment for each field of the Result object | JSONB | { "timestamp": { "validation _ comment": null, "validation _ status": "VALID" } , "fluorescence _ rfu": { "validation _ comment": null, "validation _ status": "VALID" } , "entity": { "validation _ comment": null, "validation _ status": "VALID" } } | |
Speed ( EXAMPLE ) | Individual field of Result object | Floating Point | 48 . 7 | Value dependent on field type . See field table for more information |
Color ( EXAMPLE ) | Individual field of Result object | Text | "Green" | Value dependent on field type . See field table for more information |
Resistance ( EXAMPLE ) | Individual field of Result object | Text | [ "Ampicillin", "Streptomycin" ] | Value dependent on field type . See field table for more information |
result _ field ( EXAMPLE ) | Individual field of Result object | Value dependent on field type | integer, floating point, text, blob link, etc | Value dependent on field type . See field table for more information |
--{Registry Tables}--
entity_schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
entity _ type | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry | Oligo schema are listed as dna _ sequence types . See Schema table for more information |
registry _ id | Unique identifier for an Organization's Registry | Foreign Key for reigstry . id | src _ rdw6rOsL | 1 Registry per Organization |
| prefix | Prefix selected for each schema object | Text | "p" | Prefix will always come before Registry ID for registered objects |
entity
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
file _ registry _ id | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ J3tmt8BP | If object not in folder, then folder _ id = project _ id . If null, then object not in folder/project |
project _ id | Unique identifier for project containing object | Foreign key for project . id | src _ PDSy77zE | If null, then object isn't contained within a project |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| type | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry | Oligo schema are listed as dna _ sequence types |
| validation status | Registration validation status of object | PASSED, FAILED | PASSED, FAILED | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| is_registered | denotes whether this object is registered | boolean | True |
registry_entity
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
file _ registry _ id | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ J3tmt8BP | If object not in folder, then folder _ id = project _ id . If null, then object not in folder/project |
project _ id | Unique identifier for project containing object | Foreign key for project . id | src _ PDSy77zE | If null, then object isn't contained within a project |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| type | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry, rna_oligo | Oligo schema are listed as dna _ sequence types |
| validation status | Registration validation status of object | PASSED, FAILED | PASSED, FAILED | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit |
entity_alias
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
entity _ id | The entity for which this is an alias | Foreign key for entity . id | ent _ yXrL3BjX | |
| alias | Identifier serving as the entity alias | Text | My Memorable Alias |
mixture_ingredient
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
created _ at$ | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at$ | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
mixture _ id | Unique ID for mixture object | Foreign key for mixture . id | bfi _ gQMDFBm4 | |
component _ entity _ id | Unique identifier for entity object | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
| amount | Amount of content | Floating Point | 6, 6 . 87, 7799499 . 2359, etc | |
amount _ text | Amount as text | Character Varying | 100 grams |
mixture
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
file _ registry _ id | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ J3tmt8BP | If object not in folder, then folder _ id = project _ id . If null, then object not in folder/project |
project _ id | Unique identifier for project containing object | Foreign key for project . id | src _ PDSy77zE | If null, then object isn't contained within a project |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| type | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry, rna_oligo | Oligo schema are listed as dna _ sequence types |
| validation status | Registration validation status of object | PASSED, FAILED | PASSED, FAILED | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| is_registered | denotes whether this object is registered | boolean | True | |
| amount | how much of the mixture | double | 100 | |
| units | units | Character Varying | grams | |
| allows_measured_ingredients | whether you can have measured ingredients in this mixture | boolean | true |
EXAMPLE Entity Table
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema | Unique Schema name for object | Text | "Fermentation Results" | |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
creator _ id$ | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at$ | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at$ | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| name$ | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
file _ registry _ id$ | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
schema _ id$ | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
folder _ id$ | Unique identifier for folder containing object | Foreign key for folder . id | lib _ J3tmt8BP | If object not in folder, then folder _ id = project _ id . If null, then object not in folder/project |
project _ id$ | Unique identifier for project containing object | Foreign key for project . id | src _ PDSy77zE | If null, then object isn't contained within a project |
| url$ | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit | |
| type$ | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry, rna_oligo | Oligo schema are listed as dna _ sequence types |
is _ registered$ | Is entity currently registered | Boolean | True, False | True = Entity has been registered |
Color ( EXAMPLE ) | Individual Schema Field | Text | "green" | Value dependent on field type . See field table for more information |
Plasmid ( EXAMPLE ) | Individual Schema Field | foreign key for plasmid entity | seq _ HXnZhUkT | Value dependent on field type . See field table for more information |
Length ( EXAMPLE ) | Individual Schema Field | Floating Point | 4 . 567 | Value dependent on field type . See field table for more information |
batch_schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
registry _ id | Unique identifier for an Organization's Registry | Foreign Key for reigstry . id | src _ rdw6rOsL | 1 Registry per Organization |
entity _ schema _ id | Unique identifier for schema object | Foreign key for schema . id | ts _ XDQ0OW6s |
batch
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose | Archival reason for object in Benchling | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Available archive purpose options dependent on object |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
entity _ id | Unique identifier for entity object | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
concentration _ si | Concentration value for content - note that this is in SI units, not the original units created in the application. | Floating Point | 6, 6 . 87, 7799499 . 2359, etc | |
concentration _ display _ units | Original concentration units for concentration _ si value. For example, 5 g / L will have 0.005 in the concentration _ si column and "g / L" in the concentration _ display _ units column. | Concentration Units | ug/mL | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit | |
| type | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry | Oligo schema are listed as dna _ sequence types |
--{Sample Tracking / Inventory Tables}--
location_schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose | Archival reason for object in Benchling | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Available archive purpose options dependent on object |
registry _ id | Unique identifier for an Organization's Registry | Foreign Key for reigstry . id | src _ rdw6rOsL | 1 Registry per Organization |
| prefix | Prefix selected for each schema object | Text | "p" | Prefix will always come before Registry ID for registered objects |
location
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose | Archival reason for object in Benchling | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Available archive purpose options dependent on object |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
location _ id | Unique ID for location that contains object | Foreign key for location . id | loc _ Y2v8daz0 |
box
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit | |
location _ id | Unique ID for location that contains object | Foreign key for location . id | loc _ Y2v8daz0 |
plate
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit | |
location _ id | Unique ID for location that contains object | Foreign key for location . id | loc _ Y2v8daz0 |
container
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit | |
box _ id | Unique ID for box object | Foreign key for box . id | box _ oz4ZE0MN | |
location _ id | Unique ID for location that contains object | Foreign key for location . id | loc _ Y2v8daz0 | |
plate _ id | Unique ID for plate object | Foreign key for plate . id | plt _ K9VZG06I | |
row _ index | Row position where container is located | integer | 5, 7, 12, etc | Container specific - must be in box |
column _ index | Column position where container is located | integer | 5, 7, 12, etc | Container specific - must be in box |
volume _ si | Volume value for container content - note that this is in SI units, not the original units created in the application. | Floating Point | 5, 7, 12, etc | |
volume _ display _ units | Original volume units for volume _ si value. For example, 5 mL will have 0.005 in the volume _ si column and "mL" in the volume _ display _ units column. | Text for volume units | mL, uL, nL, etc |
container_content
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
batch _ id | Unique identifier for batch object | Foreign key for batch . id | bat _ Gs8PtV0K | What batch is in the container |
container _ id | Unique ID for container object | Foreign key for container . id | con _ gQMDFBm4 | |
entity _ id | Unique identifier for entity object | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
concentration _ si | Concentration value for content - note that this is in SI units, not the original units created in the application. | Floating Point | 6, 6 . 87, 7799499 . 2359, etc | |
concentration _ display _ units | Original concentration units for concentration _ si value. For example, 5 g / L will have 0.005 in the concentration _ si column and "g / L" in the concentration _ display _ units column. | Concentration Units | ug/mL |
container_transfer
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
input _ batch _ id | Unique ID for batch to be transferred | Foreign key for batch . id | bat _ Gs8PtV0K | Transfer Table - related; not workflow related |
input _ container _ id | Unique ID for container that has entity/batch to be transferred to | Foreign key for container . id | con _ gQMDFBm4 | Transfer Table - related; not workflow related |
input _ entity _ id | Unique ID for entity to be transferred | Foreign key for registry _ entity . id | bfi _ cooUBrYb | Transfer Table - related; not workflow related |
output _ container _ id | Unique ID for newly created container | Foreign key for container . id | con _ gQMDFBm4 | Transfer Table - related; not workflow related |
volume _ si | Volume value for container content - note that this is in SI units, not the original units created in the application. | Floating Point | 5, 7, 12, etc | |
volume _ display _ units | Original volume units for volume _ si value. For example, 5 mL will have 0.005 in the volume _ si column and "mL" in the volume _ display _ units column. | Text for volume units | mL, uL, nL, etc |
--{Request Tables}--
request_schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
parent _ schema _ id | Unique identifier for schema which object is derived from | Foreign key for schema . id | ts _ XDQ0OW6s |
request_assignee
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
request _ id | Unique identifier for the request | Foreign key for request . id | req _ qPtu1MSo | |
user _ id | Unique identifier for user | Foreign key for user . id | ent _ yXrL3BjX | See User Table for more information |
team _ id | Unique identifier for the assignee's team | Foreign key for team . id | team _ oh5xGqrm |
request_fulfillment
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
request _ id | Unique identifier for the request | Foreign key for request . id | req _ qPtu1MSo | |
sample _ group _ id | ID of the schemas designated for the request | Foreign key for schema . id | ts _ gUQdTwR7 | ID's can be for containers, entities, or batches |
request _ task _ id | Unique identifier for a task within a request | Foreign key for task . id | reqtsk _ 2nzie5Io | |
entry _ id | Unique identifier for Entry | Foreign key for entry . id | etr _ GtcscEZq | See Entry Table for more information |
workflow _ id | Unique identifier for workflow containing object | Foreign key for workflow . id | wfw _ DMcZhu4A | |
| status | Status for a request ( requestor ) | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED |
request_sample
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
request _ id | Unique identifier for the request | Foreign key for request . id | req _ qPtu1MSo | |
sample _ group _ id | ID of the schemas designated for the request | Foreign key for schema . id | ts _ gUQdTwR7 | ID's can be for containers, entities, or batches |
batch _ id | Unique identifier for batch object | Foreign key for batch . id | bat _ Gs8PtV0K | What batch is in the container |
entity _ id | Unique identifier for entity object | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
container _ id | Unique ID for container object | Foreign key for container . id | con _ gQMDFBm4 | |
field _ name | Display name for field on schema | Text | "Date Sequenced" | |
row _ index | Row position where container is located | integer | 5, 7, 12, etc | Container specific - must be in box |
EXAMPLE task
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
request _ id | Unique identifier for the request | Foreign key for request . id | req _ qPtu1MSo |
EXAMPLE request
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema | Unique Schema name for object | Text | "Fermentation Results" | |
created _ at$ | Date created for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| status$ | Status for a request fulfillment | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
display _ id$ | Display name for object in Benchling | prefix - unique number | request1, request2 | |
| url$ | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit | |
scheduled _ on$ | Date which the request is to be scheduled for | datetime | 1/8/20 |
--{Workflow Tables}--
workflow
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| alias | Unique identifier for the workflow, based on prefix and sequential number | prefix - unique number | WF020 | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| description | Description given to object | Text | "Fermentation Workflow" | |
| status | Status for a request ( requestor ) | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
last _ stage _ completed | Name of last stage entry marked as complete | Text | "Transformation" | |
last _ stage _ completed _ at | Timestamp of when status of last stage entry was marked as complete | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
workflow _ template _ version _ id | API ID of workflow template used to generate this workflow | Foreign key for workflow _ template _ version . id | wfwtmplv _ 0MjnYgSk | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit |
workflow_template
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc |
workflow_template_version
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
| version | Version # for workflow template | Integer | 1,3 65, etc | Auto - incremental when new workflow version is completed |
workflow _ template _ id | Unique ID for workflow TEMPLATE | Foreign key for workflow _ template . id | wfwtmpl _ w6d11hNb |
stage_run
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
stage _ name | Stage name in Benchling | Text | "Transfection" | |
entry _ id | Unique identifier for Entry | Foreign key for entry . id | etr _ GtcscEZq | See Entry Table for more information |
workflow _ id | Unique identifier for workflow containing object | Foreign key for workflow . id | wfw _ DMcZhu4A | |
| status | Status for a request ( requestor ) | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN _ PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
exp _ condition _ values | Values available for Stage Experimental Conditions | Text | "Condition": "2" |
--{Schema Tables}--
schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
schema _ type | Schema type selected for schema of object | Text | entity, assay _ result, assay _ run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc |
field_definition
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
| position | Field number in schema | Integer | 0, 1, 5, etc | 0 = 1st field . 1 = 2nd field . . . etc |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| type | Selected type of entities for a schema object | dna _ sequence, aa _ sequence, custom _ entity, entry | dna _ sequence, aa _ sequence, custom _ entity, entry | Oligo schema are listed as dna _ sequence types |
display _ name | Display name of schema in Benchling | Text | "Cell Line" | |
numeric _ min | Minimum numeric value given for object | Integer | 0, 1, 5, etc | precision limited by number of significant figures |
numeric _ max | Maximum numeric value given for object | Integer | 0, 1, 5, etc | precision limited by number of significant figures |
is _ multi | Single or multi option identifier | TRUE, FALSE | TRUE, FALSE | |
is _ required | Identifier whether field is required or not | TRUE, FALSE | TRUE, FALSE | |
dropdown _ id | unique id of dropdown table | Foreign key for dropdown _ id in the field definition table | sfs _ ZVmOP8Ed | dropdown _ id also found in the URL for the dropdown in the Registry settings page |
target _ schema _ id | ID of target schema that points to the relationship link | Foreign key for entity _ schema . id | ts _ XDQ0OW6s |
[DEPRECATED] field
Applied filter(s): LINKED_FIELD_IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
schema _ id | Unique identifier for schema containing object | Foreign key for schema . id | ts _ IOGwR6u4 | |
field _ defiintion _ id | Unique id of field definition for object in table | Foreign key for field _ defition . id | schema _ field _ 42365 | See field _ definition Table |
field _ name | Display name for field on schema | Text | "Date Sequenced" | |
batch _ id | Unique identifier for batch object | Foreign key for batch . id | bat _ Gs8PtV0K | What batch is in the container |
box _ id | Unique ID for box object | Foreign key for box . id | box _ oz4ZE0MN | |
container _ id | Unique ID for container object | Foreign key for container . id | con _ gQMDFBm4 | |
entry _ id | Unique identifier for Entry | Foreign key for entry . id | etr _ GtcscEZq | See Entry Table for more information |
location _ id | Unique ID for location that contains object | Foreign key for location . id | loc _ Y2v8daz0 | |
plate _ id | Unique ID for plate object | Foreign key for plate . id | plt _ K9VZG06I | |
registry _ entity _ id | unique id of any registered entity | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
request _ id | Unique identifier for the request | Foreign key for request . id | req _ qPtu1MSo | |
run _ id | Unique identifier for the run | Foreign key for assay _ run . id | multi _ a11d82b2 - 8df3 - 44ae - bb2e - 89086c8b69a4 _ file | |
display _ value | Text value of identified field | Text | "Amp" | |
blob _ value | Blob link value in JSON format of identified field | JSON value | { id, name, url } | Attached file can be found in Benchling |
float _ value | Floating point value of identified field | Floating Point | 2, 4 . 56, 4334 . 6493, etc | |
date _ value | Date format value of identified field | datetime | 1/8/20 | |
datetime _ value | Date format with timestamp value of identified field | Timestamp with timezone | 2019 - 12 - 05T19:15:00 | |
integer _ value | Integer value of identified field | Integer | 1, 2, 54, etc | |
json _ value | JSON value of identified field | JSON Value | ||
linked _ batch _ id | Unique id of any batch the field object is linked to | Foreign key for batch . id | bat _ Gs8PtV0K | |
linked _ box _ id | Unique id of any box the field object is linked to | Foreign key for box . id | box _ oz4ZE0MN | |
linked _ container _ id | Unique id of any container the field object is linked to | Foreign key for container . id | con _ gQMDFBm4 | |
linked _ entry _ id | Unique id of any entry the field object is linked to | Foreign key for entry . id | etr _ GtcscEZq | |
linked _ location _ id | Unique id of any location the field object is linked to | Foreign key for location . id | loc _ Y2v8daz0 | |
linked _ plate _ id | Unique id of any plate the field object is linked to | Foreign key for plate . id | plt _ S5ALalNc | |
linked _ result _ id | Unique id of any result the field object is linked to | Foreign key for result . id | 6498dd5a - 1b4b - 4954 - 826f - bfcfd1496373 | |
linked _ run _ id | Unique id of any run the field object is linked to | Foreign key for run . id | 343494f6 - e633 - 4523 - 9aa6 - 26898c99f482 | |
linked _ registry _ entity _ id | Unique id of any registered entity the field object is linked oo | Foreign key for registry _ entity . id | bfi _ cooUBrYb | |
value _ index | The position number of a given value for a field that supports multiple values | Integer ( or null ) | null, 1, 2, 6, etc | "null" = Not Multiselect . 1,2,3,4, etc = Position of multi - select field |
dropdown
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Character Varying | sfs_jBu9uUnv, etc. | Primary key for a table |
| name | Name of dropdown in Benchling | Character Varying | Color, Analytes, etc. | |
| archived$ | Archival state for dropdown in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for dropdown in Benchling | Character Varying | null, Made in Error, Retired, Other, etc | null = object not archived |
dropdown_option
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Character Varying | sfso_2v93jfF9, etc. | Primary key for a table |
| dropdown_id | Reference to parent dropdown ID | Character Varying | sfs_jBu9uUnv, etc. | Refers to dropdown.id |
| name | Name of dropdown option in Benchling | Character Varying | Color, Analytes, etc. | |
| position | Relative position of dropdown option in the dropdown | Integer | 0, 3, etc. | Ranges from 0 to (# options in dropdown - 1) |
| archived$ | Archival state for dropdown option in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for dropdown option in Benchling | Character Varying | null, Made in Error, Retired, Other, etc | null = object not archived |
--{Folder / Project Tables}--
project
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit |
folder
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
archive _ purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
created _ at | Created date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
modified _ at | Most recent modified date for object | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
parent _ folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ J3tmt8BP |
--{User Tables}--
principal
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
| handle | Unique username chosen by individual users or username defined for a Benchling Apps | Text | "ssiegfried" | Handle can be changed at any point to any other unique string of text/integers |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| Unique email associated with each user account , column will be null for Benchling App accounts | "benchlingsupport@benchling . com" | |||
is _ suspended | Suspension status for each user or app | FALSE, TRUE | FALSE, TRUE | TRUE = Suspended user |
created _ at | Created date for user or app | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 |
user
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
| handle | Unique username chosen by individual users | Text | "ssiegfried" | Handle can be changed at any point to any other unique string of text/integers |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| Unique email associated with each user account | "benchlingsupport@benchling . com" | |||
is _ suspended | Suspension status for each user | FALSE, TRUE | FALSE, TRUE | TRUE = Suspended user |
created _ at | Created date for user | Timestamp without timezone | 2019 - 12 - 06T23:24:44 . 885478 |
team_member
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
team _ id | Unique identifier for the assignee's team | Foreign key for team . id | team _ oh5xGqrm | |
user _ id | Unique identifier for user | Foreign key for user . id | ent _ yXrL3BjX | See User Table for more information |
| role | Team membership status for an individual user | ADMIN, MEMBER | ADMIN, MEMBER |
team
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| description | Description given to object | Text | "Fermentation Workflow" |
--{Molecular Biology Tables}--
Note: These tables exist only in their $raw form; consider performing a JOIN on the relevant schema table.
DNA Sequnce$raw
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Unique identifier for the request | Character Varying | Transfection Entry, Therapeutic Cell Line | |
| bases | A string representing the bases that make up the DNA Sequence | Character Varying | agtctgttgggatggccacttaccacatcgtaccccta [...] | |
| bases_length_exceeds_limit | Whether or not the length of the
field exceeds the limit | Boolean | false |
DNA Oligo$raw
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | ent _ yXrL3BjX, etr _ GtcscEZq, loc _ Y2v8daz0, etc | Primary key for a table |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Unique identifier for the request | Character Varying | Transfection Entry, Therapeutic Cell Line | |
| bases | A string representing the bases that make up the DNA Oligo | Character Varying | agtctgttgggatggccacttaccacatcgtaccccta [...] |
--{Workflow Tables}--
Workflow Task Group
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | prs _ hVI52tJk | |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | |
| name | Name of object in Benchling | Character varying | Analytical SEC 26 | |
display _ id | Unique identifier surfaced in the actual Benchling site | Prefix - unique number | SEC26 | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
modified _ at | Most recent modified date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
| url | URL for each object in Benchling | Browser URL | . benchling . com/demo/f/lib _ LDMZLtYM - media - prep/prs _ hVI52tJk - - analytical - sec - 26/edit | |
folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ LDMZLtYM | |
execution _ type | Selected type for how tasks are executed | ENTRY, DIRECT | ENTRY, DIRECT | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
archive _ purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| workflow_flowchart_node_config_id | Unique identifier for workflow_flowchart_node_config | Foreign key for workflow_flowchart_node_config.id | wffcnc_giVNQcTL | |
| workflow_flowchart_config_version_id | Unique identifier for workflow_flowchart_config_version | Foreign key for workflow_flowchart_config_version.id | wffccv_giVNQcAF |
Workflow Task Schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | prstsch _ 0JAxhOhS | |
schema _ type | Schema type selected for schema of object | Text | workflow _ task | Always workflow _ task for this table |
| name | Name of object in Benchling | Character varying | Analytical SEC | |
system _ name | Name of warehouse table for this schema | Character varying | analytical _ sec | |
execution _ type | Selected type for how tasks are executed | ENTRY, DIRECT | ENTRY, DIRECT | |
| prefix | Prefix used when creating workflow tasks from this schema | Character varying | SEC | |
workflow _ task _ group _ prefix | Prefix used when creating workflow task groups from this schema | Character varying | SEC | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
modified _ at | Most recent modified date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
| url | URL for each object in Benchling | Browser URL | . benchling . com/demo/f/lib _ LDMZLtYM - media - prep/prs _ hVI52tJk - - analytical - sec - 26/edit | |
can _ set _ assignee _ on _ task _ creation | Determines if assignees can be set when a task is created | Boolean | TRUE, FALSE | |
folder _ id | Unique identifier for folder containing object | Foreign key for folder . id | lib _ LDMZLtYM | |
workflow _ task _ status _ lifecycle _ id | Unique identifier for workflow _ task _ status _ lifecycle | Foreign key for workflow _ task _ status _ lifecycle . id | prstswf _ J8s40D7l | |
default _ responsible _ team _ id | Unique identifier for team | Foreign key for team . id | team _ oh5xGqrm | |
default _ creation _ folder _ id | Unique identifier for default folder where tasks of this schema are created | Foreign key for folder . id | lib _ LDMZLtYM | |
default _ entry _ execution _ folder _ id | Unique identifier for default folder where tasks of this schema are executed | Foreign key for folder . id | lib _ LDMZLtYM | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
archive _ purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc |
Workflow Task
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | wftask _ hVI52tJk | |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | |
display _ id | Unique identifier surfaced in the actual Benchling site | Prefix - unique number | SEC26 - T5 | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
modified _ at | Most recent modified date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
scheduled _ on _ date | Date the task is scheduled to be performed | Date | 2020 - 06 - 04 | |
assignee _ id | Unique identifier for assigned user | Foreign key for user . id | ent _ yXrL3BjX | |
workflow _ task _ group _ id | Unique identifier for workflow _ task _ group | Foreign key for workflow _ task _ group . id | prs _ hVI52tJk | |
workflow _ task _ schema _ id | Unique identifier for workflow _ task _ schema | Foreign key for workflow _ task _ schema . id | prstsch _ 0JAxhOhS | |
workflow _ task _ status _ id | Unique identifier for workflow _ task _ status | Foreign key for workflow _ task _ status . id | wfts _ A6CmVrOp | |
execution _ entry _ id | Unique identifier for entry | Foreign key for entry . id | etr _ GtcscEZq | |
execution _ user _ id | Unique identifier for user | Foreign key for user . id | ent _ yXrL3BjX | |
executed _ on | Date the task was executed | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
| archived$ | Archival state for object in Benchling | Boolean | FALSE, TRUE | |
archive _ purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| workflow_flowchart_id | Unique identifier for workflow_flowchart | Foreign key for workflow_flowchart.id | wffc_giVNQcAF | |
| workflow_flowchart_task_id | Unique identifier for a flowchart workflow_task | Foreign key for workflow_task.id | wftask_OnnsW08k |
Workflow Output Schema
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | prsosch _ kz6y7T4o | |
schema _ type | Schema type selected for schema of object | Text | workflow _ output | Always workflow _ output for this table |
| name | Name of object in Benchling | Character varying | Analytical SEC | |
system _ name | Name of warehouse table for this schema | Character varying | analytical _ sec | |
| prefix | Prefix used when creating workflow tasks from this schema | Character varying | SEC | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
archive _ purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc |
Workflow Output
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | wftask _ hVI52tJk | |
source _ id | The project or registry that the object's permissions comes from | Foreign key for project . id or registry . id | src _ hh9ffHqV | |
display _ id | Unique identifier surfaced in the actual Benchling site | Prefix - unique number | SEC26 - T5 | |
creator _ id | Unique identifier for creator of object | Foreign key for user . id | ent _ yXrL3BjX | |
created _ at | Created date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
modified _ at | Most recent modified date for object | Timestamp without time zone | 2020 - 06 - 04T00:11:56 . 132400 | |
workflow _ task _ group _ id | Unique identifier for workflow _ task _ group | Foreign key for workflow _ task _ group . id | prs _ hVI52tJk | |
workflow _ task _ id | Unique identifier for workflow _ task that output is for | Foreign key for workflow _ task . id | wftask _ hVI52tJk | |
workflow _ task _ status _ id | Unique identifier for workflow _ task _ status | Foreign key for workflow _ task _ status . id | wfts _ A6CmVrOp | |
workflow _ output _ schema _ id | Unique identifier for workflow _ output _ schema | Foreign key for workflow _ output _ schema . id | prsosch _ kz6y7T4o | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
archive _ purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc |
Workflow Task Status
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | wfts _ A6CmVrOp | |
display _ name | Name of object in Benchling | Character varying | Completed | |
status _ type | Type of status | PENDING, IN _ PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID | PENDING, IN _ PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID |
Workflow Task Status Lifecycle
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | prstswf _ J8s40D7l | |
| name | Name of object in Benchling | Character varying | Entry Review | |
schema _ execution _ type | Type of execution for task schemas using this lifecycle | DIRECT, ENTRY | DIRECT, ENTRY | |
initial _ workflow _ task _ status _ id | Unique identifier for workflow _ task _ status | Foreign key for workflow _ task _ status . id | wfts _ A6CmVrOp | The first status of the lifecycle . lifecycle edges determine the rest of the status order . |
Workflow Task Status Lifecycle Edge
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling - prescribed ID for each line item in table | Format dependent on table | prstswfe _ aziohrUt | |
workflow _ task _ status _ lifecycle _ id | Unique identifier for workflow _ task _ status _ lifecycle | Foreign key for workflow _ task _ status _ lifecycle . id | prstswf _ J8s40D7l | Lifecycle that the edge is for |
from _ workflow _ task _ status _ id | Unique identifier for workflow _ task _ status | Foreign key for workflow _ task _ status . id | wfts _ A6CmVrOp | The starting status of the edge |
to _ workflow _ task _ status _ id | Unique identifier for workflow _ task _ status | Foreign key for workflow _ task _ status . id | wfts _ Td7q3eiM | The ending status of the edge |
Workflow Flowchart
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffc_giVNQcAF |
Workflow Flowchart Node Config
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffcnc_giVNQWcXS | |
| workflow_task_schema_id | Unique identifier for workflow_task_schema | Foreign key for workflow_task_schema.id | prstsch_OnnsV06w |
Workflow Flowchart Edge Config
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffcec_poVNQcQE | |
| workflow_flowchart_id | Unique identifier for workflow_flowchart | Foreign key for workflow_flowchart.id | wffc_giVNQcAF | |
| from_flowchart_node_config_id | Unique identifier for workflow_flowchart_node_config | Foreign key for workflow_flowchart_node_config.id | wffcnc_mcMKcXS | |
| to_node_config_id | Unique identifier for workflow_flowchart_node_config | Foreign key for workflow_flowchart_node_config.id | wffcnc_nwICpoe |
Workflow Lineage Edge
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wfle_kmQWplX | |
| to_workflow_task_id | Unique identifier for workflow_task | Foreign key for workflow_task.id | wftask_OnnsW08k | |
| from_workflow_task_id | Unique identifier for workflow_task | Foreign key for workflow_task.id | wftask_OnnsW08k | |
| to_workflow_output_id | Unique identifier for workflow_output | Foreign key for workflow_output | wfout_5cJLQKVF | |
| from_workflow_output_id | Unique identifier for workflow_output | Foreign key for workflow_output.id | wfout_5cJLQKVF |
Workflow Flowchart Config Version
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffccv_giVNQcAF | |
| workflow_flowchart_config_id | Unique identifier for workflow_flowchart_config | Foreign key for workflow_flowchart_config.id | wffcc_wcIJAPL | |
| workflow_flowchart_id | Unique identifier for workflow_flowchart | Foreign key for workflow_flowchart.id | wffc_giVNQcAF |
Workflow Chart Config
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|---|---|---|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffcc_wcIJAPL | |
| workflow_task_schema_id | Unique identifier for workflow_task_schema | Foreign key for workflow_task_schema.id | prstsch_OnnsV06w |
Updated almost 2 years ago
