Create RnaSequence | Benchling Documentation

curl -X POST https://{tenant_name}.benchling.com/api/v3/rna-sequence \
     -H "Authorization: Bearer <token>" \
     -H "Content-Type: application/json" \
     -d '{
  "folderId": "lib_o2thOLlq",
  "name": "CRISPR guide RNA",
  "annotations": [
    {
      "end": 8,
      "name": "Target region",
      "start": 2,
      "color": "#FF6B6B",
      "notes": "Gene silencing target",
      "type": "target"
    }
  ],
  "bases": "AUCGAUCGAUCGAUCGAUCGAU",
  "parts": [
    {
      "end": 4,
      "sequenceId": "seq_jdf8BV24",
      "start": 0
    }
  ],
  "primers": [
    {
      "location": {
        "locationType": "start_and_end",
        "end": 4,
        "start": 0
      },
      "oligoId": "seq_laGnl8vB",
      "strand": "FORWARD"
    }
  ],
  "schemaFields": {
    "application": {
      "value": "CRISPR"
    },
    "target_gene": {
      "value": "BRCA1"
    }
  },
  "schemaId": "ts_ztQQGSSF",
  "translations": [
    {
      "regions": [
        {
          "end": 7,
          "start": 1
        }
      ],
      "customFields": [
        {
          "name": "reading_frame",
          "value": "1"
        }
      ],
      "geneticCode": "STANDARD",
      "name": "ORF fragment",
      "translateFirstCodonToMethionine": true
    }
  ]
}'

{
  "__typename": "__typename",
  "authors": "authors",
  "creator": {
    "__typename": "__typename",
    "id": "id"
  },
  "schemaFields": [
    {
      "__typename": "__typename",
      "id": "id",
      "linkedEntityId": "linkedEntityId"
    }
  ],
  "aliases": [
    "aliases"
  ],
  "annotations": "annotations",
  "archiveReason": "archiveReason",
  "archived": true,
  "bases": "bases",
  "canonicalHelm": "canonicalHelm",
  "createdAt": "createdAt",
  "customFields": [
    {
      "__typename": "__typename",
      "name": "name",
      "value": "value"
    }
  ],
  "entityRegistryId": "entityRegistryId",
  "folder": {
    "__typename": "__typename",
    "id": "id"
  },
  "id": "id",
  "modifiedAt": "modifiedAt",
  "modifiedNucleotides": "modifiedNucleotides",
  "name": "name",
  "nucleotideAlignments": "nucleotideAlignments",
  "parts": "parts",
  "primers": "primers",
  "project": {
    "__typename": "__typename",
    "id": "id"
  },
  "registrationOrigin": {
    "__typename": "__typename",
    "originEntry": {
      "__typename": "__typename",
      "id": "id"
    },
    "registeredAt": "registeredAt"
  },
  "registry": {
    "__typename": "__typename",
    "id": "id"
  },
  "schema": {
    "__typename": "__typename",
    "id": "id"
  },
  "translations": "translations",
  "typedSchema": {
    "__typename": "__typename",
    "id": "id"
  }
}

Create an RNA sequence in a folder. name and folderId are required.

Sequence specification

Provide exactly one of the following:

bases — plain nucleotide sequence
helm — HELM notation (requires the modified nucleotides feature to be enabled)
customNotation with customNotationId — vendor-specific notation (requires custom syntaxes to be enabled; both fields must be set together)

Authentication

AuthorizationBearer

Bearer authentication of the form Bearer <token>, where token is your auth token.

Request

This endpoint expects an object.

folderIdstringRequired

namestringRequired

Name of the item.

aliaseslist of stringsOptional

Array of aliases

annotationslist of objectsOptional

Annotations on the RNA sequence, not including translations or primers. Annotations on parts are not included.

authorIdslist of stringsOptional

basesstringOptional

Bases of the RNA sequence. Mutually exclusive with helm and customNotation.

customFieldsmap from strings to objectsOptional

Custom fields set on the RNA sequence.

customNotationstring or nullOptional

Sequence in a vendor-specific custom notation syntax. Requires custom syntaxes to be enabled. When customNotation is set, customNotationId is required. Mutually exclusive with bases and helm.

customNotationIdstring or nullOptional

ID of the custom notation syntax used to interpret customNotation. When customNotation is set, customNotationId is required; omit both when using bases or helm.

entityRegistryIdstringOptional

Registry ID to assign to the entity. If one is specified, the labeling_strategy must be unspecified.

helmstringOptional

HELM notation for the RNA sequence and chemical modifications. Requires the modified nucleotides feature to be enabled. Mutually exclusive with bases and customNotation.

namingStrategyenumOptional

Strategy to use for labeling the item in the registry. If one is specified, the entity_registry_id must be unspecified.

partslist of objectsOptional

Part features linking regions of this sequence to other RNA sequences.

primerslist of objectsOptional

Primer bind features on the RNA sequence. Primers on parts are not included.

registryIdstring or nullOptional

A not null value means the entity should be registered. If not null, the value must match the registry of the item's schema.

schemaFieldsmap from strings to objectsOptional

schemaIdstringOptional

translationslist of objectsOptional

Translation annotations present on the RNA sequence. Translations may be one region or split across multiple regions. Translations on parts are not included.

Response

Created

__typenamestringOptional

authorsstring or nullOptionalformat: "uri"

creatorobject or nullOptional

schemaFieldslist of objects or nullOptional

aliaseslist of strings or nullOptional

Array of aliases

annotationsstringOptionalformat: "uri"

Annotations on the RNA sequence, not including translations or primers. Annotations on parts are not included.

archiveReasonstring or nullOptional

archivedbooleanOptional

basesstringOptional

Bases of the RNA sequence.

canonicalHelmstringOptional

Normalized HELM notation for this RNA sequence.

createdAtstring or nullOptional

customFieldslist of objects or nullOptional

Custom fields set on the RNA sequence.

entityRegistryIdstring or nullOptional

The registry-assigned identifier for this item (e.g. its registry ID shown in the UI), present only once the item has been registered. Null if the item is not registered.

folderobject or nullOptional

idstringOptional

modifiedAtstring or nullOptional

modifiedNucleotidesstringOptionalformat: "uri"

Modifications applied to this RNA sequence.

namestringOptional

Name of the item.

nucleotideAlignmentsstringOptionalformat: "uri"

Nucleotide alignments that use this sequence as the reference sequence. For template alignments, this is the template sequence; for consensus alignments, this is the derived consensus sequence.

partsstringOptionalformat: "uri"

Part features linking regions of this sequence to other RNA sequences.

primersstringOptionalformat: "uri"

Primer bind features on the RNA sequence. Primers on parts are not included.

projectobject or nullOptional

registrationOriginobject or nullOptional

Provenance of this item’s registration — where and when it was registered. Null if unregistered.

registryobject or nullOptional

The Registry this item belongs to, if registered. Null if unregistered.

schemaobject or nullOptional

Use typedSchema instead, which returns the per-type schema.

translationsstringOptionalformat: "uri"

Translation annotations present on the RNA sequence. Translations may be one region or split across multiple regions. Translations on parts are not included.

typedSchemaobject or nullOptional

Errors

400

Rna Sequence Create Request Bad Request Error

403

Rna Sequence Create Request Forbidden Error

404

Rna Sequence Create Request Not Found Error

409

Rna Sequence Create Request Conflict Error

429

Rna Sequence Create Request Too Many Requests Error

500

Rna Sequence Create Request Internal Server Error