Warehouse Table Columns

Note that this page doesn't display tables as well as we'd hope. Please zoom in your browser with CTRL-+ or CMD-+.

The Benchling Warehouse Columns Descriptions

Each Benchling Warehouse (WH) table has many columns that represent the data contained in each table. Use the following information help understand how each table can be used to directly query the data you have stored in Benchling.

To see all Benchling Tables in diagram format please navigate to https://docs.benchling.com/docs/warehouse-tables-v2

The following information is outlined below for every WH table:

1. Column Name
2. Column Definition
3. Value Type
4. Example Values
5. Useful Notes

📘

Tables vs. $raw tables

As discussed in Warehouse Tables, these tables are Postgres views that represent a "cleaned up" version of the raw data. For applicable tables, we've specified the filter(s) being applied to the raw data in order to produce the cleaned table. These filters are described here:

Filter key	Filter description
IS_NOT_ARCHIVED	Filters away rows where the archived$ column is True
LINKED_FIELD_IS_NOT_ARCHIVED	Filters away rows in the field table where the corresponding row in the field_definition table's archived$ column is True. This look up is an outer join on field.field_definition_id = field_definition.id
STATIC_IS_REVIEWED	Performs a join between the entry$raw table and the result table (result.entry_id = entry.id). Filters away rows whose corresponding entry IS NOT accepted (entry$raw.review_status != ACCEPTED)
STATIC_IS_VALID	Filters away result rows where validation_status IS NOT NULL AND the value is not VALID or PARTIALLY_VALID.

--{Notebook Tables}--

See below for all tables relating to the Benchling Notebook

entry

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Primary key for a Warehouse table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Format dependent on table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
display_id	Unique identifier surfaced in the actual Benchling site	prefix-unique entry number	EXP001 or EXP20000416	I.E Unique Entry number
folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_J3tmt8BP	If object not in folder, then folder_id = project_id.If null, then object not in folder/project
workflow_id	Unique identifier for workflow containing object	Foreign key for workflow.id	wfw_DMcZhu4A
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
review_process_version_id	Unique identifier for version id of review process	Foreign key for review_process_version.id	rlc_SN0IwfBx
review_status	Current review status for object	null, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED	null, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED
review_requested_at	Date of most recent review requested for object	Timestamp without timezone	2019-12-06T23:24:44.885478	Date of most recent review request
review_status_changed_at	Date of review status change for object	Timestamp without timezone	2019-12-06T23:24:44.885478
url	url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP-Entry%20Namet/etr\_gRogHFOb-untitled/edit
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX

entry_auditor

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
user_id	Unique identifier for user	Foreign key for user.id	ent_yXrL3BjX	See User Table for more information
entry_id	Unique identifier for Entry	Foreign key for entry.id	etr_GtcscEZq	See Entry Table for more information
review_process_stage_id	Unique identifier for review process stage	null , Foreign key for review_process_stage.id	rlcstg_ZjNgNXks

author

bnch$creation_context$alpha

Table Row	Definition	Value Type	Example values ( if applicable )	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_ GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
created_object_id	Unique identifier for the created object	Foreign key for any type of object that can have a creation context	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
entry_id	Unique identifier for the notebook entry that the object was created in	Foreign key for entry.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
worksheet_id	Unique identifier for the worksheet that the object was created in	Foreign key for worksheet.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
procedure_step_execution_id	Unique identifier for the the associated procedure step execution instance for the worksheet step that the object was created in	Foreign key for procedure_step_execution_isntance.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
parameter_measured_value_id	Unique identifier for the created procedure parameter measured value	Foreign key for parameter_measured_value.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
parameter_confirmation_value_id	Unique identifier for the created procedure parameter confirmation value	Foreign key for parameter_confirmation_value.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
parameter_planned_value_id	Unique identifier for the created procedure parameter planned value	Foreign key for parameter_planned_value.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
run_id	Unique identifier for the created lab auto run	Character varying	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
result_id	Unique identifier for the created result	Foreign key for result.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
entity_id	Unique identifier for the created entity	Foreign key for entity.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
box_id	Unique identifier for the created box	Foreign key for box.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
plate_id	Unique identifier for the created plate	Foreign key for plate.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
container_id	Unique identifier for the created container	Foreign key for container.id	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc

review_process

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
current_version	Version id of the current (i.e. most up-to-date) review process version	Foreign key for review_process_version.id	rlc_6x2onGXv

project_review_process

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
project_id	Unique identifier for project	Foreign key for project.id	src_D44xhOol
review_process_id	Unique identifier for review process	Foreign key for review_process.id	rlc_fSmNiu8i

review_process_version

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
review_process_id	Unique identifier for review process	Foreign key for review_process.id	rlc_fSmNiu8i
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
name	Name of the review processes version	Character Varying	Self Review RLC, Lab Sequential
lifecycle_type	Review process type	Enumeration	SELF_REVIEW , SEQUENTIAL , PARALLEL
completion_stage	Status of a completed review using review process	Character Varying	ACCEPTED

review_process_stage

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
name	Name of the review process stage	Character Varying	Self review, Stage 1
action	Text appearing in the user-facing label when completing stage	Character Varying	ACCEPT
review_process_version_id	Unique identifier for version id of review process	Foreign key for review_process_version.id	rlc_SN0IwfBx

--{Lab Automation Tables}--

EXAMPLE Lab Auto table

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	identifier of the run	Character varying	ee6da040-fa64-4e47-9a5e-98892fa32580
v3_id	identifier of the run	Character varying		API identifier used in future versions of the Benchling API. May be null while in development.
source_id	project that the run is in	Character varying	src_RWL0Oekn
schema	lab auto schema this run is part of	Character varying	transfection_v1_schema
created_at$	when the run was created	timestamp without time zone	2020-06-04T00:11:56.132400
creator_id$	who created it	Character varying	ent_naLWig4C
entry_id$	which entry it was created in	Character varying	etr_nLrUvmPx
archived$	whether the run was archived	boolean	false
archive_purpose$	reason for why the run was archived, if archived	Character varying	null
validation_status$	validation status	Character varying	VALID
validation_comment$	validation information	Character varying	null
plate	custom created columns as part of the run configuration	Character varying	"plt_2Q09VfYn"

--{Procedures Tables}--

bnch$procedure_run$alpha

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
study_id	Unique identifier for the parent study of the procedure run	Foreign key for study.id	stdy_iG0LW1XU
procedure_id	Unique identifier for the template procedure that the procedure run was created from	Character Varying	pc_aX3ST2SH
workflow_task_id	Unique identifier for associated Workflow task	Foreign key for workflow_task.id	wftask_gLZqJzcl
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived

bnch$procedure_method_execution_instance$alpha

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
procedure_run_id	Unique identifier for parent procedure run	Character Varying	pcr_gLZqJzcl
workflow_task_id	Unique identifier for associated Workflow task	Foreign key for workflow_task.id	wftask_gLZqJzcl
worksheet_id	Unique identifier for associated worksheet	Foreign key for worksheet.id	wks_gLZqJzcl
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived

bnch$procedure_method_task_transition$alpha

Table row	Definition	Value type	Examples values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
method_execution_instance_id	Unique identifier for the associated method execution instance	Foreign key for procedure_method_execution_instance.id	pmei_hh9ffHqV
transitioned_at	Time entered when the associated Workflow task was transitioned to the status specified in status_display_name	Timestamp without timezone	2019-12-06T23:24:44.885478
status_display_name	Status of Workflow task associated with the method	Character varying	In progress, Failed, Skipped
comment	Comment, if any, associated with transitioning (starting, completing, skipping, or failing) the method	Character Varying	Delayed

bnch$procedure_step_execution_instance$alpha

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_ hh9ffHqV
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
position	Zero-indexed position of the step within a step group	Integer	0, 1
step_group_type	Type of the parent step group	Character Varying	PRE_RUN, RUN
workflow_task_id	Unique identifier for associated Workflow task	Foreign key for workflow_task.id	wftask_gLZqJzcl
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived

bnch$parameter_planned_value$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
name	Name of parent parameter in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
method_execution_instance_id	Unique identifier for the execution instance of a method for a replicate of a condition	Foreign key for procedure_method_execution_instance.id	pcmei_Bz5Dlmu5	Methods are referred to as “unit operations” in the Benchling UI
parameter_type	Parameter type of the parent parameter	Character Varying	EQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETER	Data parameters are referred to as “parameters” in the Benchling UI
parameter_id	Unique identifier for the parent parameter	Character Varying	pcparam_cCO8Dvfc	Can be used for queries across multiple executions of the same procedure
value	The planned value for the parameter	JSON value	350, null, bfi_GuPYFZQH, water
type	Data type of the parent parameter version	Character Varying	entity_link, text, float
unit_id	Unique identifier for the unit associated with the parent parameter version	Foreign key for unit.id	null, unit_aWP1Asqp
amount	The planned amount for a material input. Will always be null for other parameter types.	Floating point	null, 4.2
amount_unit_id	Unique identifier for the amount unit for a material input. Will always be null for other parameter types.	Foreign key for unit.id	null, unit_aWP1Asqp
container_id	1Unique identifier for the associated container	Foreign key for container.id	null, con_wQM2Lshs

bnch$parameter_confirmation_value$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
name	Name of parent parameter in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
method_execution_instance_id	Unique identifier for the execution instance of a method for a replicate of a condition	Foreign key for procedure_method_execution_instance.id	pcmei_Bz5Dlmu5	Methods are referred to as “unit operations” in the Benchling UI
parameter_type	Parameter type of the parent parameter	Character Varying	EQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETER	Data parameters are referred to as “parameters” in the Benchling UI
parameter_id	Unique identifier for the parent parameter	Character Varying	pcparam_cCO8Dvfc	Can be used for queries across multiple executions of the same procedure
value	The confirmed value for the parameter	JSON value	350, null, bfi_GuPYFZQH, water
type	Data type of the parent parameter version	Character Varying	entity_link, text, float
unit_id	Unique identifier for the unit associated with the parent parameter version	Foreign key for unit.id	null, unit_aWP1Asqp
amount	The planned amount for a material input. Will always be null for other parameter types.	Floating point	null, 4.2
amount_unit_id	Unique identifier for the amount unit for a material input. Will always be null for other parameter types.	Foreign key for unit.id	null, unit_aWP1Asqp
container_id	1Unique identifier for the associated container	Foreign key for container.id	null, con_wQM2Lshs
recorded_at	The date/time that the parameter was confirmed, or for material inputs, was added	Timestamp without time zone	null, 2024-09-06T14:38:29
comment	Comment, if any, associated with the parameter confirmation	Character Varying	Using more salt	Blank comments are stored as an empty string

bnch$parameter_measured_value$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
name	Name of parent parameter in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
method_execution_instance_id	Unique identifier for the execution instance of a method for a replicate of a condition	Foreign key for procedure_method_execution_instance.id	pcmei_Bz5Dlmu5	Methods are referred to as “unit operations” in the Benchling UI
parameter_type	Parameter type of the parent parameter	Character Varying	EQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETER	Data parameters are referred to as “parameters” in the Benchling UI
parameter_id	Unique identifier for the parent parameter	Character Varying	pcparam_cCO8Dvfc	Can be used for queries across multiple executions of the same procedure
value	The measured value for the parameter	JSON value	350, null, bfi_GuPYFZQH, water
type	Data type of the parent parameter version	Character Varying	entity_link, text, float
unit_id	Unique identifier for the unit associated with the parent parameter version	Foreign key for unit.id	null, unit_aWP1Asqp
amount	The planned amount for a material input. Will always be null for other parameter types.	Floating point	null, 4.2
amount_unit_id	Unique identifier for the amount unit for a material input. Will always be null for other parameter types.	Foreign key for unit.id	null, unit_aWP1Asqp
container_id	1Unique identifier for the associated container	Foreign key for container.id	null, con_wQM2Lshs
recorded_at	The date/time that the parameter was confirmed, or for material inputs, was added	Timestamp without time zone	null, 2024-09-06T14:38:29
comment	Comment, if any, associated with the parameter confirmation	Character Varying	Using more salt	Blank comments are stored as an empty string

bnch$parameter_value_plate_well$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
plate_id	Unique identifier for the plate	Foreign key for plate.id	plt_wQM2Lshs
parameter_confirmation_value_id	Unique identifier a confirmed parameter value	Foreign key for parameter_confirmation_value.id	ppvc_aWP1Asqp
parameter_planned_value_id	Unique identifier a planned parameter value	Foreign key for parameter_planned_value.id	ppvp_aWP1Asqp
well_position	Position of the plate well where the parameter value was confirmed	Character Varying	A3

bnch$procedure_run_condition$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
description	Description of the condition	Character Varying	Control
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
procedure_run_id	Unique identifier for the parent procedure run	Foreign key for procedure_run.id	prc_wa2kjuQaQ

bnch$procedure_run_condition_replicate$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
condition_id	Unique identifier for the parent condition	Foreign key for procedure_run_condition.id	pcrc_wa2kjuQaQ
replicate_number	Unique identifier for the replicate within the condition group	Integer	1

bnch$procedure_method_condition_replicate$alpha

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_ yXrL3BjX, etr _ GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project that the object's permissions comes from	Foreign key for project.id	src_hh9ffHqV
procedure_run_condition_replicate_id	Unique identifier for a specific replicate of a condition	Foreign key for procedure_run_condition_replicate_id	prcr_qHF3HNaT
method_execution_instance_id	Unique identifier for the execution instance of a method (unit operation) for a replicate of a condition	Foreign key for procedure_method_execution_instance.id	pcmei_Bz5Dlmu5

--{Results Tables}--

assay_run_schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
parent_schema_id	Unique identifier for schema which object is derived from	Foreign key for schema.id	ts_XDQ0OW6s

assay_result_schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
parent_schema_id	Unique identifier for schema which object is derived from	Foreign key for schema.id	ts_XDQ0OW6s

EXAMPLE Result table

Applied filter(s): IS_NOT_ARCHIVED, STATIC_IS_REVIEWED, STATIC_IS_VALID

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
v3_id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table		API identifier used in future versions of the Benchling API. May be null while in development.
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
schema	Unique Schema name for object	Text	"Fermentation Results"
created_at$	Date created for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at$	Date object was modified in Benchling	Timestamp without timezone	2019-12-08T22:34:55.174635
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
custom$	Any custom created columns will be shown here	JSONB	{}	Custom Columns are created after a result table has been entered into a Notebook entry
entity	The Entity an object is mapped to	Foreign key for registry_entity.id	bfi_cooUBrYb
entry_id$	Unique identifier for Entry	Foreign key for entry.id	etr_GtcscEZq	See Entry Table for more information
run_id$	Unique identifier for Entry	Foreign key for run.id	a11d82b2-8df3-44ae-bb2e-89086c8b69a4	See Entry Table for more information
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
validation_status$	Validation status for individual result object	VALID, INVALID	VALID, INVALID
validation_comment$	Validation comment for individual result object	Text	"Standard curve failure"
field_validation$	Validation comment for each field of the Result object	JSONB	{"timestamp":{"validation_comment": null, "validation_status": "VALID"}, "fluorescence_rfu":{"validation_comment": null, "validation_status": "VALID"}, "entity":{"validation_comment": null, "validation_status": "VALID"}}
Speed(EXAMPLE)	Individual field of Result object	Floating Point	48.7	Value dependent on field type.See field table for more information
Color(EXAMPLE)	Individual field of Result object	Text	"Green"	Value dependent on field type.See field table for more information
Resistance(EXAMPLE)	Individual field of Result object	Text	["Ampicillin", "Streptomycin"]	Value dependent on field type.See field table for more information
result_field(EXAMPLE)	Individual field of Result object	Value dependent on field type	integer, floating point, text, blob link, etc	Value dependent on field type.See field table for more information

--{Registry Tables}--

entity_schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
entity_type	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry	Oligo schema are listed as dna_sequence types.See Schema table for more information
registry_id	Unique identifier for an Organization's Registry	Foreign Key for reigstry.id	src_rdw6rOsL	1 Registry per Organization
prefix	Prefix selected for each schema object	Text	"p"	Prefix will always come before Registry ID for registered objects

entity

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_id	Unique Benchling Registry ID associated with each registered entity	Text	"p001"
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_J3tmt8BP	If object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_id	Unique identifier for project containing object	Foreign key for project.id	src_PDSy77zE	If null, then object isn't contained within a project
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
type	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry	Oligo schema are listed as dna_sequence types
validation status	Registration validation status of object	PASSED, FAILED	PASSED, FAILED
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
is_registered	denotes whether this object is registered	boolean	True

registration_origin

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	registration_origin_bfi_EVf5Yd8r	Primary key for a table
source_id	The registry	Foreign key to registry.id	src_hh9ffHqV
entity_id	The entity	Foreign key to entity.id	bfi_EVf5Yd8r
registered_at	Timestamp when entity was registered	Timestamp without timezone	2023-07-26T21:46:53.670489
origin_entry_id	Unique identifier for Entry	Foreign key to entry.id	etr_EuoDTxy1

registry_entity

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_id	Unique Benchling Registry ID associated with each registered entity	Text	"p001"
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_J3tmt8BP	If object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_id	Unique identifier for project containing object	Foreign key for project.id	src_PDSy77zE	If null, then object isn't contained within a project
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
type	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry, rna_oligo	Oligo schema are listed as dna_sequence types
validation status	Registration validation status of object	PASSED, FAILED	PASSED, FAILED
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit

entity_alias

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
entity_id	The entity for which this is an alias	Foreign key for entity.id	ent_yXrL3BjX
alias	Identifier serving as the entity alias	Text	My Memorable Alias

mixture_ingredient

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
created_at$	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at$	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
mixture_id	Unique ID for mixture object	Foreign key for mixture.id	bfi_gQMDFBm4
component_entity_id	Unique identifier for entity object	Foreign key for registry_entity.id	bfi_cooUBrYb
amount	Amount of content	Floating Point	6, 6.87, 7799499.2359, etc
amount_text	Amount as text	Character Varying	100 grams

mixture

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_id	Unique Benchling Registry ID associated with each registered entity	Text	"p001"
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_J3tmt8BP	If object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_id	Unique identifier for project containing object	Foreign key for project.id	src_PDSy77zE	If null, then object isn't contained within a project
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
type	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry, rna_oligo	Oligo schema are listed as dna_sequence types
validation status	Registration validation status of object	PASSED, FAILED	PASSED, FAILED
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
is_registered	denotes whether this object is registered	boolean	True
amount	how much of the mixture	double	100
units	units	Character Varying	grams
allows_measured_ingredients	whether you can have measured ingredients in this mixture	boolean	true

EXAMPLE Entity Table

Table Row	Definition	Value Type	Example values (if applicable)	Notes
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
schema	Unique Schema name for object	Text	"Fermentation Results"
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
creator_id$	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at$	Created date for object (when the entity was originally created)	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at$	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
name$	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_id$	Unique Benchling Registry ID associated with each registered entity	Text	"p001"
schema_id$	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
folder_id$	Unique identifier for folder containing object	Foreign key for folder.id	lib_J3tmt8BP	If object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_id$	Unique identifier for project containing object	Foreign key for project.id	src_PDSy77zE	If null, then object isn't contained within a project
url$	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
type$	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry, rna_oligo	Oligo schema are listed as dna_sequence types
is_registered$	Is entity currently registered	Boolean	True, False	True = Entity has been registered
Color(EXAMPLE)	Individual Schema Field	Text	"green"	Value dependent on field type.See field table for more information
Plasmid(EXAMPLE)	Individual Schema Field	foreign key for plasmid entity	seq_HXnZhUkT	Value dependent on field type.See field table for more information
Length(EXAMPLE)	Individual Schema Field	Floating Point	4.567	Value dependent on field type.See field table for more information

batch_schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
registry_id	Unique identifier for an Organization's Registry	Foreign Key for reigstry.id	src_rdw6rOsL	1 Registry per Organization
entity_schema_id	Unique identifier for schema object	Foreign key for schema.id	ts_XDQ0OW6s

batch

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose	Archival reason for object in Benchling	Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other	Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other	Available archive purpose options dependent on object
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
entity_id	Unique identifier for entity object	Foreign key for registry_entity.id	bfi_cooUBrYb
concentration_si	Concentration value for content - note that this is in SI units, not the original units created in the application.	Floating Point	6, 6.87, 7799499.2359, etc
concentration_display_units	Original concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column.	Concentration Units	ug/mL
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
type	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry	Oligo schema are listed as dna_sequence types

--{Sample Tracking / Inventory Tables}--

location_schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose	Archival reason for object in Benchling	Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other	Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other	Available archive purpose options dependent on object
registry_id	Unique identifier for an Organization's Registry	Foreign Key for reigstry.id	src_rdw6rOsL	1 Registry per Organization
prefix	Prefix selected for each schema object	Text	"p"	Prefix will always come before Registry ID for registered objects

location

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose	Archival reason for object in Benchling	Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other	Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other	Available archive purpose options dependent on object
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
barcode	Displays benchling barcode of the object	Text	15MLFALCON006
location_id	Unique ID for location that contains object	Foreign key for location.id	loc_Y2v8daz0

box

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
barcode	Displays benchling barcode of the object	Text	15MLFALCON006
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
location_id	Unique ID for location that contains object	Foreign key for location.id	loc_Y2v8daz0

plate

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
barcode	Displays benchling barcode of the object	Text	15MLFALCON006
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
location_id	Unique ID for location that contains object	Foreign key for location.id	loc_Y2v8daz0

container

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
barcode	Displays benchling barcode of the object	Text	15MLFALCON006
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
box_id	Unique ID for box object	Foreign key for box.id	box_oz4ZE0MN
location_id	Unique ID for location that contains object	Foreign key for location.id	loc_Y2v8daz0
plate_id	Unique ID for plate object	Foreign key for plate.id	plt_K9VZG06I
row_index	Row position where container is located	integer	5, 7, 12, etc	Container specific-must be in box
column_index	Column position where container is located	integer	5, 7, 12, etc	Container specific-must be in box
volume_si	Volume value for container content - note that this is in SI units, not the original units created in the application.	Floating Point	5, 7, 12, etc
volume_display_units	Original volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column.	Text for volume units	mL, uL, nL, etc
checkout_status	Indicates whether the container is checked-out, reserved, or available.	character varying	AVAILABLE, RESERVED, CHECKED_OUT
checkout_status_modified_at	The date the container was last checked out, reserved, or checked in	timestamp without time zone	2020-06-04T00:11:56.132400
checkout_assignee_team_id	Unique ID for the team the container is checked out or reserved for	character varying	team_oh5xGqrm, null	null = checkout assignee is a user
checkout_assignee_user_id	Unique ID for the user the container is checked out or reserved for	character varying	ent_naLWig4, null	null = checkout assignee is a team
restriction_status	NOT_APPLICABLE for fixed plate wells and RESTRICTED or UNRESTRICTED for other containers	character varying	RESTRICTED, UNRESTRICTED, NOT_APPLICABLE

container_content

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
batch_id	Unique identifier for batch object	Foreign key for batch.id	bat_Gs8PtV0K	What batch is in the container
container_id	Unique ID for container object	Foreign key for container.id	con_gQMDFBm4
entity_id	Unique identifier for entity object	Foreign key for registry_entity.id	bfi_cooUBrYb
concentration_si	Concentration value for content - note that this is in SI units, not the original units created in the application.	Floating Point	6, 6.87, 7799499.2359, etc
concentration_display_units	Original concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column.	Concentration Units	ug/mL

container_transfer

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
input_batch_id	Unique ID for batch to be transferred	Foreign key for batch.id	bat_Gs8PtV0K	Transfer Table-related; not workflow related
input_container_id	Unique ID for container that has entity/batch to be transferred to	Foreign key for container.id	con_gQMDFBm4	Transfer Table-related; not workflow related
input_entity_id	Unique ID for entity to be transferred	Foreign key for registry_entity.id	bfi_cooUBrYb	Transfer Table-related; not workflow related
output_container_id	Unique ID for newly created container	Foreign key for container.id	con_gQMDFBm4	Transfer Table-related; not workflow related
volume_si	Volume value for container content - note that this is in SI units, not the original units created in the application.	Floating Point	5, 7, 12, etc
volume_display_units	Original volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column.	Text for volume units	mL, uL, nL, etc

sample_owner

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	character varying	con_gQMDFBm4_ent_naLWig4C, con_gQMDFBm4_team_oh5xGqrm
container_id	Foreign key for container.id	character varying	con_gQMDFBm4
team_id	Unique ID for a team that is a sample owner for the container	character varying	team_oh5xGqrm, null	null = sample owner is a user
user_id	Unique ID for a user who is a sample owner for the container	character varying	ent_naLWig4C, null	null = sample owner is a team

restricted_sample_party

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	character varying	con_gQMDFBm4_ent_naLWig4C, con_gQMDFBm4_team_oh5xGqrm
container_id	Foreign key for container.id	character varying	con_gQMDFBm4
team_id	Unique ID for a team that is a sample owner for the container	character varying	team_oh5xGqrm, null	null = sample owner is a user
user_id	Unique ID for a user who is a sample owner for the container	character varying	ent_naLWig4C, null	null = sample owner is a team

--{Request Tables}--

request_schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
parent_schema_id	Unique identifier for schema which object is derived from	Foreign key for schema.id	ts_XDQ0OW6s

request_assignee

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
request_id	Unique identifier for the request	Foreign key for request.id	req_qPtu1MSo
user_id	Unique identifier for user	Foreign key for user.id	ent_yXrL3BjX	See User Table for more information
team_id	Unique identifier for the assignee's team	Foreign key for team.id	team_oh5xGqrm

request_fulfillment

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
request_id	Unique identifier for the request	Foreign key for request.id	req_qPtu1MSo
sample_group_id	ID of the schemas designated for the request	Foreign key for schema.id	ts_gUQdTwR7	ID's can be for containers, entities, or batches
request_task_id	Unique identifier for a task within a request	Foreign key for task.id	reqtsk_2nzie5Io
entry_id	Unique identifier for Entry	Foreign key for entry.id	etr_GtcscEZq	See Entry Table for more information
workflow_id	Unique identifier for workflow containing object	Foreign key for workflow.id	wfw_DMcZhu4A
status	Status for a request(requestor)	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED

request_sample

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
request_id	Unique identifier for the request	Foreign key for request.id	req_qPtu1MSo
sample_group_id	ID of the schemas designated for the request	Foreign key for schema.id	ts_gUQdTwR7	ID's can be for containers, entities, or batches
batch_id	Unique identifier for batch object	Foreign key for batch.id	bat_Gs8PtV0K	What batch is in the container
entity_id	Unique identifier for entity object	Foreign key for registry_entity.id	bfi_cooUBrYb
container_id	Unique ID for container object	Foreign key for container.id	con_gQMDFBm4
field_name	Display name for field on schema	Text	"Date Sequenced"
row_index	Row position where container is located	integer	5, 7, 12, etc	Container specific-must be in box

EXAMPLE task

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
request_id	Unique identifier for the request	Foreign key for request.id	req_qPtu1MSo

EXAMPLE request

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
schema	Unique Schema name for object	Text	"Fermentation Results"
created_at$	Date created for object	Timestamp without timezone	2019-12-06T23:24:44.885478
status$	Status for a request fulfillment	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
display_id$	Display name for object in Benchling	prefix-unique number	request1, request2
url$	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
scheduled_on$	Date which the request is to be scheduled for	datetime	1/8/20

--{Workflow Tables}--

workflow

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
alias	Unique identifier for the workflow, based on prefix and sequential number	prefix-unique number	WF020
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
description	Description given to object	Text	"Fermentation Workflow"
status	Status for a request(requestor)	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
last_stage_completed	Name of last stage entry marked as complete	Text	"Transformation"
last_stage_completed_at	Timestamp of when status of last stage entry was marked as complete	Timestamp without timezone	2019-12-06T23:24:44.885478
workflow_template_version_id	API ID of workflow template used to generate this workflow	Foreign key for workflow_template_version.id	wfwtmplv_0MjnYgSk
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit

workflow_template

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc

workflow_template_version

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
version	Version#for workflow template	Integer	1,3 65, etc	Auto-incremental when new workflow version is completed
workflow_template_id	Unique ID for workflow TEMPLATE	Foreign key for workflow_template.id	wfwtmpl_w6d11hNb

stage_run

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
stage_name	Stage name in Benchling	Text	"Transfection"
entry_id	Unique identifier for Entry	Foreign key for entry.id	etr_GtcscEZq	See Entry Table for more information
workflow_id	Unique identifier for workflow containing object	Foreign key for workflow.id	wfw_DMcZhu4A
status	Status for a request(requestor)	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED	IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
exp_condition_values	Values available for Stage Experimental Conditions	Text	"Condition": "2"

--{Schema Tables}--

schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
schema_type	Schema type selected for schema of object	Text	entity, assay_result, assay_run, request, location, box, container, plate, batch	See Schema table for more information
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc

field_definition

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
position	Field number in schema	Integer	0, 1, 5, etc	0 = 1st field.1 = 2nd field...etc
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
type	Selected type of entities for a schema object	dna_sequence, aa_sequence, custom_entity, entry	dna_sequence, aa_sequence, custom_entity, entry	Oligo schema are listed as dna_sequence types
display_name	Display name of schema in Benchling	Text	"Cell Line"
numeric_min	Minimum numeric value given for object	Integer	0, 1, 5, etc	precision limited by number of significant figures
numeric_max	Maximum numeric value given for object	Integer	0, 1, 5, etc	precision limited by number of significant figures
is_multi	Single or multi option identifier	TRUE, FALSE	TRUE, FALSE
is_required	Identifier whether field is required or not	TRUE, FALSE	TRUE, FALSE
dropdown_id	unique id of dropdown table	Foreign key for dropdown_id in the field definition table	sfs_ZVmOP8Ed	dropdown_id also found in the URL for the dropdown in the Registry settings page
target_schema_id	ID of target schema that points to the relationship link	Foreign key for entity_schema.id	ts_XDQ0OW6s

[DEPRECATED] field

Applied filter(s): LINKED_FIELD_IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
schema_id	Unique identifier for schema containing object	Foreign key for schema.id	ts_IOGwR6u4
field_defiintion_id	Unique id of field definition for object in table	Foreign key for field_defition.id	schema_field_42365	See field_definition Table
field_name	Display name for field on schema	Text	"Date Sequenced"
batch_id	Unique identifier for batch object	Foreign key for batch.id	bat_Gs8PtV0K	What batch is in the container
box_id	Unique ID for box object	Foreign key for box.id	box_oz4ZE0MN
container_id	Unique ID for container object	Foreign key for container.id	con_gQMDFBm4
entry_id	Unique identifier for Entry	Foreign key for entry.id	etr_GtcscEZq	See Entry Table for more information
location_id	Unique ID for location that contains object	Foreign key for location.id	loc_Y2v8daz0
plate_id	Unique ID for plate object	Foreign key for plate.id	plt_K9VZG06I
registry_entity_id	unique id of any registered entity	Foreign key for registry_entity.id	bfi_cooUBrYb
request_id	Unique identifier for the request	Foreign key for request.id	req_qPtu1MSo
run_id	Unique identifier for the run	Foreign key for assay_run.id	multi_a11d82b2-8df3-44ae-bb2e-89086c8b69a4_file
display_value	Text value of identified field	Text	"Amp"
blob_value	Blob link value in JSON format of identified field	JSON value	{id, name, url}	Attached file can be found in Benchling
float_value	Floating point value of identified field	Floating Point	2, 4.56, 4334.6493, etc
date_value	Date format value of identified field	datetime	1/8/20
datetime_value	Date format with timestamp value of identified field	Timestamp with timezone	2019-12-05T19:15:00
integer_value	Integer value of identified field	Integer	1, 2, 54, etc
json_value	JSON value of identified field	JSON Value
linked_batch_id	Unique id of any batch the field object is linked to	Foreign key for batch.id	bat_Gs8PtV0K
linked_box_id	Unique id of any box the field object is linked to	Foreign key for box.id	box_oz4ZE0MN
linked_container_id	Unique id of any container the field object is linked to	Foreign key for container.id	con_gQMDFBm4
linked_entry_id	Unique id of any entry the field object is linked to	Foreign key for entry.id	etr_GtcscEZq
linked_location_id	Unique id of any location the field object is linked to	Foreign key for location.id	loc_Y2v8daz0
linked_plate_id	Unique id of any plate the field object is linked to	Foreign key for plate.id	plt_S5ALalNc
linked_result_id	Unique id of any result the field object is linked to	Foreign key for result.id	6498dd5a-1b4b-4954-826f-bfcfd1496373
linked_run_id	Unique id of any run the field object is linked to	Foreign key for run.id	343494f6-e633-4523-9aa6-26898c99f482
linked_registry_entity_id	Unique id of any registered entity the field object is linked oo	Foreign key for registry_entity.id	bfi_cooUBrYb
value_index	The position number of a given value for a field that supports multiple values	Integer(or null)	null, 1, 2, 6, etc	"null" = Not Multiselect.1,2,3,4, etc = Position of multi-select field

dropdown

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Character Varying	sfs_jBu9uUnv, etc.	Primary key for a table
name	Name of dropdown in Benchling	Character Varying	Color, Analytes, etc.
archived$	Archival state for dropdown in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for dropdown in Benchling	Character Varying	null, Made in Error, Retired, Other, etc	null = object not archived

dropdown_option

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Character Varying	sfso_2v93jfF9, etc.	Primary key for a table
dropdown_id	Reference to parent dropdown ID	Character Varying	sfs_jBu9uUnv, etc.	Refers to dropdown.id
name	Name of dropdown option in Benchling	Character Varying	Color, Analytes, etc.
position	Relative position of dropdown option in the dropdown	Integer	0, 3, etc.	Ranges from 0 to (# options in dropdown - 1)
archived$	Archival state for dropdown option in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for dropdown option in Benchling	Character Varying	null, Made in Error, Retired, Other, etc	null = object not archived

--{Folder / Project Tables}--

project

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
url	url for each object in Benchling	Browser URL	https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit

folder

Applied filter(s): IS_NOT_ARCHIVED

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
archived$	Archival state for object in Benchling	Boolean	TRUE, FALSE	true = object archived
archive_purpose$	Archival reason for object in Benchling	Text	null, Made in Error, Retired, Other, etc	null = object not archived
created_at	Created date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
modified_at	Most recent modified date for object	Timestamp without timezone	2019-12-06T23:24:44.885478
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
parent_folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_J3tmt8BP

--{User Tables}--

principal

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
handle	Unique username chosen by individual users or username defined for a Benchling Apps	Text	"ssiegfried"	Handle can be changed at any point to any other unique string of text/integers
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
email	Unique email associated with each user account , column will be null for Benchling App accounts	Email	"[email protected]"
is_suspended	Suspension status for each user or app	FALSE, TRUE	FALSE, TRUE	TRUE = Suspended user
created_at	Created date for user or app	Timestamp without timezone	2019-12-06T23:24:44.885478

user

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
handle	Unique username chosen by individual users	Text	"ssiegfried"	Handle can be changed at any point to any other unique string of text/integers
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
email	Unique email associated with each user account	Email	"[email protected]"
is_suspended	Suspension status for each user	FALSE, TRUE	FALSE, TRUE	TRUE = Suspended user
created_at	Created date for user	Timestamp without timezone	2019-12-06T23:24:44.885478

team_member

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
team_id	Unique identifier for the assignee's team	Foreign key for team.id	team_oh5xGqrm
user_id	Unique identifier for user	Foreign key for user.id	ent_yXrL3BjX	See User Table for more information
role	Team membership status for an individual user	ADMIN, MEMBER	ADMIN, MEMBER

team

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
name	Name of object in Benchling	Character Varying	Transfection Entry, QC Results, Therapeutic Cell Line, etc
description	Description given to object	Text	"Fermentation Workflow"

--{Molecular Biology Tables}--

Note: These tables exist only in their $raw form; consider performing a JOIN on the relevant schema table.

DNA Sequnce$raw

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
name	Unique identifier for the request	Character Varying	Transfection Entry, Therapeutic Cell Line
bases	A string representing the bases that make up the DNA Sequence	Character Varying	agtctgttgggatggccacttaccacatcgtaccccta [...]
bases_length_exceeds_limit	Whether or not the length of the bases field exceeds the limit	Boolean	false

DNA Oligo$raw

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc	Primary key for a table
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV	If an object isn't in a project, the permissions will be derived from the Registry
name	Unique identifier for the request	Character Varying	Transfection Entry, Therapeutic Cell Line
bases	A string representing the bases that make up the DNA Oligo	Character Varying	agtctgttgggatggccacttaccacatcgtaccccta [...]

--{Workflow Tables}--

Workflow Task Group

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	prs_hVI52tJk
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV
name	Name of object in Benchling	Character varying	Analytical SEC 26
display_id	Unique identifier surfaced in the actual Benchling site	Prefix-unique number	SEC26
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
modified_at	Most recent modified date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
url	URL for each object in Benchling	Browser URL	https://demo.benchling.com/demo/f/lib_LDMZLtYM-media-prep/prs_hVI52tJk--analytical-sec-26/edit
folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_LDMZLtYM
execution_type	Selected type for how tasks are executed	ENTRY, DIRECT	ENTRY, DIRECT
archived$	Archival state for object in Benchling	boolean	FALSE, TRUE
archive_purpose$	Archival reason for object in Benchling	Character varying	null, Made in Error, Retired, Other, etc
workflow_flowchart_node_config_id	Unique identifier for workflow_flowchart_node_config	Foreign key for workflow_flowchart_node_config.id	wffcnc_giVNQcTL
workflow_flowchart_config_version_id	Unique identifier for workflow_flowchart_config_version	Foreign key for workflow_flowchart_config_version.id	wffccv_giVNQcAF

Workflow Task Schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	prstsch_0JAxhOhS
schema_type	Schema type selected for schema of object	Text	workflow_task	Always workflow_task for this table
name	Name of object in Benchling	Character varying	Analytical SEC
system_name	Name of warehouse table for this schema	Character varying	analytical_sec
execution_type	Selected type for how tasks are executed	ENTRY, DIRECT	ENTRY, DIRECT
prefix	Prefix used when creating workflow tasks from this schema	Character varying	SEC
workflow_task_group_prefix	Prefix used when creating workflow task groups from this schema	Character varying	SEC
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
modified_at	Most recent modified date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
url	URL for each object in Benchling	Browser URL	https://demo.benchling.com/demo/f/lib_LDMZLtYM-media-prep/prs_hVI52tJk--analytical-sec-26/edit
can_set_assignee_on_task_creation	Determines if assignees can be set when a task is created	Boolean	TRUE, FALSE
folder_id	Unique identifier for folder containing object	Foreign key for folder.id	lib_LDMZLtYM
workflow_task_status_lifecycle_id	Unique identifier for workflow_task_status_lifecycle	Foreign key for workflow_task_status_lifecycle.id	prstswf_J8s40D7l
default_responsible_team_id	Unique identifier for team	Foreign key for team.id	team_oh5xGqrm
default_creation_folder_id	Unique identifier for default folder where tasks of this schema are created	Foreign key for folder.id	lib_LDMZLtYM
default_entry_execution_folder_id	Unique identifier for default folder where tasks of this schema are executed	Foreign key for folder.id	lib_LDMZLtYM
archived$	Archival state for object in Benchling	boolean	FALSE, TRUE
archive_purpose$	Archival reason for object in Benchling	Character varying	null, Made in Error, Retired, Other, etc

Workflow Task

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wftask_hVI52tJk
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV
display_id	Unique identifier surfaced in the actual Benchling site	Prefix-unique number	SEC26-T5
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
modified_at	Most recent modified date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
scheduled_on_date	Date the task is scheduled to be performed	Date	2020-06-04
assignee_id	Unique identifier for assigned user	Foreign key for user.id	ent_yXrL3BjX
workflow_task_group_id	Unique identifier for workflow_task_group	Foreign key for workflow_task_group.id	prs_hVI52tJk
workflow_task_schema_id	Unique identifier for workflow_task_schema	Foreign key for workflow_task_schema.id	prstsch_0JAxhOhS
workflow_task_status_id	Unique identifier for workflow_task_status	Foreign key for workflow_task_status.id	wfts_A6CmVrOp
execution_entry_id	Unique identifier for entry	Foreign key for entry.id	etr_GtcscEZq
execution_user_id	Unique identifier for user	Foreign key for user.id	ent_yXrL3BjX
executed_on	Date the task was executed	Timestamp without time zone	2020-06-04T00:11:56.132400
archived$	Archival state for object in Benchling	Boolean	FALSE, TRUE
archive_purpose$	Archival reason for object in Benchling	Character varying	null, Made in Error, Retired, Other, etc
workflow_flowchart_id	Unique identifier for workflow_flowchart	Foreign key for workflow_flowchart.id	wffc_giVNQcAF
workflow_flowchart_task_id	Unique identifier for a flowchart workflow_task	Foreign key for workflow_task.id	wftask_OnnsW08k

Workflow Output Schema

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	prsosch_kz6y7T4o
schema_type	Schema type selected for schema of object	Text	workflow_output	Always workflow_output for this table
name	Name of object in Benchling	Character varying	Analytical SEC
system_name	Name of warehouse table for this schema	Character varying	analytical_sec
prefix	Prefix used when creating workflow tasks from this schema	Character varying	SEC
archived$	Archival state for object in Benchling	boolean	FALSE, TRUE
archive_purpose$	Archival reason for object in Benchling	Character varying	null, Made in Error, Retired, Other, etc

Workflow Output

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wftask_hVI52tJk
source_id	The project or registry that the object's permissions comes from	Foreign key for project.id or registry.id	src_hh9ffHqV
display_id	Unique identifier surfaced in the actual Benchling site	Prefix-unique number	SEC26-T5
creator_id	Unique identifier for creator of object	Foreign key for user.id	ent_yXrL3BjX
created_at	Created date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
modified_at	Most recent modified date for object	Timestamp without time zone	2020-06-04T00:11:56.132400
workflow_task_group_id	Unique identifier for workflow_task_group	Foreign key for workflow_task_group.id	prs_hVI52tJk
workflow_task_id	Unique identifier for workflow_task that output is for	Foreign key for workflow_task.id	wftask_hVI52tJk
workflow_task_status_id	Unique identifier for workflow_task_status	Foreign key for workflow_task_status.id	wfts_A6CmVrOp
workflow_output_schema_id	Unique identifier for workflow_output_schema	Foreign key for workflow_output_schema.id	prsosch_kz6y7T4o
archived$	Archival state for object in Benchling	boolean	FALSE, TRUE
archive_purpose$	Archival reason for object in Benchling	Character varying	null, Made in Error, Retired, Other, etc

Workflow Task Status

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wfts_A6CmVrOp
display_name	Name of object in Benchling	Character varying	Completed
status_type	Type of status	PENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID	PENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID

Workflow Task Status Lifecycle

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	prstswf_J8s40D7l
name	Name of object in Benchling	Character varying	Entry Review
schema_execution_type	Type of execution for task schemas using this lifecycle	DIRECT, ENTRY	DIRECT, ENTRY
initial_workflow_task_status_id	Unique identifier for workflow_task_status	Foreign key for workflow_task_status.id	wfts_A6CmVrOp	The first status of the lifecycle.lifecycle edges determine the rest of the status order.

Workflow Task Status Lifecycle Edge

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	prstswfe_aziohrUt
workflow_task_status_lifecycle_id	Unique identifier for workflow_task_status_lifecycle	Foreign key for workflow_task_status_lifecycle.id	prstswf_J8s40D7l	Lifecycle that the edge is for
from_workflow_task_status_id	Unique identifier for workflow_task_status	Foreign key for workflow_task_status.id	wfts_A6CmVrOp	The starting status of the edge
to_workflow_task_status_id	Unique identifier for workflow_task_status	Foreign key for workflow_task_status.id	wfts_Td7q3eiM	The ending status of the edge

Workflow Flowchart

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wffc_giVNQcAF

Workflow Flowchart Node Config

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wffcnc_giVNQWcXS
workflow_task_schema_id	Unique identifier for workflow_task_schema	Foreign key for workflow_task_schema.id	prstsch_OnnsV06w

Workflow Flowchart Edge Config

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wffcec_poVNQcQE
workflow_flowchart_id	Unique identifier for workflow_flowchart	Foreign key for workflow_flowchart.id	wffc_giVNQcAF
from_flowchart_node_config_id	Unique identifier for workflow_flowchart_node_config	Foreign key for workflow_flowchart_node_config.id	wffcnc_mcMKcXS
to_node_config_id	Unique identifier for workflow_flowchart_node_config	Foreign key for workflow_flowchart_node_config.id	wffcnc_nwICpoe

Workflow Lineage Edge

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wfle_kmQWplX
to_workflow_task_id	Unique identifier for workflow_task	Foreign key for workflow_task.id	wftask_OnnsW08k
from_workflow_task_id	Unique identifier for workflow_task	Foreign key for workflow_task.id	wftask_OnnsW08k
to_workflow_output_id	Unique identifier for workflow_output	Foreign key for workflow_output	wfout_5cJLQKVF
from_workflow_output_id	Unique identifier for workflow_output	Foreign key for workflow_output.id	wfout_5cJLQKVF

Workflow Flowchart Config Version

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wffccv_giVNQcAF
workflow_flowchart_config_id	Unique identifier for workflow_flowchart_config	Foreign key for workflow_flowchart_config.id	wffcc_wcIJAPL
workflow_flowchart_id	Unique identifier for workflow_flowchart	Foreign key for workflow_flowchart.id	wffc_giVNQcAF

Workflow Chart Config

Table Row	Definition	Value Type	Example values (if applicable)	Notes
id	Unique Benchling-prescribed ID for each line item in table	Format dependent on table	wffcc_wcIJAPL
workflow_task_schema_id	Unique identifier for workflow_task_schema	Foreign key for workflow_task_schema.id	prstsch_OnnsV06w