Warehouse Table Columns

❗️

This page has now been retired

Please update any bookmarks to point to the new Warehouse Tables page.

Note that this page doesn't display tables as well as we'd hope. Please zoom in your browser with CTRL-+ or CMD-+.

The Benchling Warehouse Columns Descriptions

Each Benchling Warehouse (WH) table has many columns that represent the data contained in each table. Use the following information help understand how each table can be used to directly query the data you have stored in Benchling.

To see all Benchling Tables in diagram format please navigate to https://docs.benchling.com/docs/warehouse-tables-v2

The following information is outlined below for every WH table:

  1. Column Name
  2. Column Definition
  3. Value Type
  4. Example Values
  5. Useful Notes
📘

Tables vs. $raw tables

As discussed in Warehouse Tables, these tables are Postgres views that represent a "cleaned up" version of the raw data. For applicable tables, we've specified the filter(s) being applied to the raw data in order to produce the cleaned table. These filters are described here:

Filter keyFilter description
IS_NOT_ARCHIVEDFilters away rows where the archived$ column is True
LINKED_FIELD_IS_NOT_ARCHIVEDFilters away rows in the field table where the corresponding row in the field_definition table's archived$ column is True. This look up is an outer join on field.field_definition_id = field_definition.id
STATIC_IS_REVIEWEDPerforms a join between the entry$raw table and the result table (result.entry_id = entry.id). Filters away rows whose corresponding entry IS NOT accepted (entry$raw.review_status != ACCEPTED)
STATIC_IS_VALIDFilters away result rows where validation_status IS NOT NULL AND the value is not VALID or PARTIALLY_VALID.


--{Notebook Tables}--

See below for all tables relating to the Benchling Notebook

entry

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tablePrimary key for a Warehouse tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcFormat dependent on table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
display_idUnique identifier surfaced in the actual Benchling siteprefix-unique entry numberEXP001 or EXP20000416I.E Unique Entry number
folder_idUnique identifier for folder containing objectForeign key for folder.idlib_J3tmt8BPIf object not in folder, then folder_id = project_id.If null, then object not in folder/project
workflow_idUnique identifier for workflow containing objectForeign key for workflow.idwfw_DMcZhu4A
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
review_process_version_idUnique identifier for version id of review processForeign key for review_process_version.idrlc_SN0IwfBx
review_statusCurrent review status for objectnull, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTEDnull, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED
review_requested_atDate of most recent review requested for objectTimestamp without timezone2019-12-06T23:24:44.885478Date of most recent review request
review_status_changed_atDate of review status change for objectTimestamp without timezone2019-12-06T23:24:44.885478
urlurlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP-Entry%20Namet/etr\_gRogHFOb-untitled/edit
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX

entry_auditor

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
user_idUnique identifier for userForeign key for user.ident_yXrL3BjXSee User Table for more information
entry_idUnique identifier for EntryForeign key for entry.idetr_GtcscEZqSee Entry Table for more information
review_process_stage_idUnique identifier for review process stage

null

, Foreign key for review_process_stage.id

rlcstg_ZjNgNXks

author

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
user_idUnique identifier for userForeign key for user.ident_yXrL3BjXSee User Table for more information
entry_idUnique identifier for EntryForeign key for entry.idetr_GtcscEZqIf entry has multiple authors there will be multiple rows per entry_id. See Entry Table for more information

bnch$creation_context$beta

Table RowDefinitionValue Type

Example values

(

if applicable

)

Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr GtcscEZq, locY2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
created_object_idUnique identifier for the created objectForeign key for any type of object that can have a creation contextent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
entry_idUnique identifier for the notebook entry that the object was created inForeign key for entry.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
worksheet_idUnique identifier for the worksheet that the object was created inForeign key for worksheet.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
procedure_step_execution_idUnique identifier for the the associated procedure step execution instance for the worksheet step that the object was created inForeign key for procedure_step_execution_isntance.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
parameter_measured_value_idUnique identifier for the created procedure parameter measured valueForeign key for parameter_measured_value.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
parameter_confirmation_value_idUnique identifier for the created procedure parameter confirmation valueForeign key for parameter_confirmation_value.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
parameter_planned_value_idUnique identifier for the created procedure parameter planned valueForeign key for parameter_planned_value.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
run_idUnique identifier for the created lab auto runCharacter varyingent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
result_idUnique identifier for the created resultForeign key for result.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
entity_idUnique identifier for the created entityForeign key for entity.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
box_idUnique identifier for the created boxForeign key for box.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
plate_idUnique identifier for the created plateForeign key for plate.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
container_idUnique identifier for the created containerForeign key for container.ident_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc

review_process

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
current_versionVersion id of the current (i.e. most up-to-date) review process versionForeign key for review_process_version.idrlc_6x2onGXv

project_review_process

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
project_idUnique identifier for projectForeign key for project.idsrc_D44xhOol
review_process_idUnique identifier for review processForeign key for review_process.idrlc_fSmNiu8i

review_process_version

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
review_process_idUnique identifier for review processForeign key for review_process.idrlc_fSmNiu8i
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
nameName of the review processes versionCharacter VaryingSelf Review RLC, Lab Sequential
lifecycle_typeReview process typeEnumeration

SELF_REVIEW

,

SEQUENTIAL

,

PARALLEL

completion_stageStatus of a completed review using review processCharacter VaryingACCEPTED

review_process_stage

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
nameName of the review process stageCharacter VaryingSelf review, Stage 1
actionText appearing in the user-facing label when completing stageCharacter VaryingACCEPT
review_process_version_idUnique identifier for version id of review processForeign key for review_process_version.idrlc_SN0IwfBx

--{Lab Automation Tables}--

EXAMPLE Lab Auto table

Table RowDefinitionValue TypeExample values (if applicable)Notes
ididentifier of the runCharacter varyingee6da040-fa64-4e47-9a5e-98892fa32580
v3_ididentifier of the runCharacter varying

API identifier used in future versions of the Benchling API. May be

null

while in development.

source_idproject that the run is inCharacter varyingsrc_RWL0Oekn
schemalab auto schema this run is part ofCharacter varyingtransfection_v1_schema
created_at$when the run was createdtimestamp without time zone2020-06-04T00:11:56.132400
creator_id$who created itCharacter varyingent_naLWig4C
entry_id$which entry it was created inCharacter varyingetr_nLrUvmPx
archived$whether the run was archivedbooleanfalse
archive_purpose$reason for why the run was archived, if archivedCharacter varyingnull
validation_status$validation statusCharacter varyingVALID
validation_comment$validation informationCharacter varyingnull
platecustom created columns as part of the run configurationCharacter varying"plt_2Q09VfYn"

--{Procedures Tables}--

Definitions

TermDefinition
ProcedureA template for the recipe or assay. Lives in a template collection.
Procedure runAn actual execution of a procedure. This object lives in a project and has method execution instances that are associated with Workflow tasks that the user will work through. Also referred to as an experiment run in the UI.
Procedure run conditionCondition
Procedure run condition replicateA single replicate of a condition. The UI doesn't have a singular term for this.
MethodUnit operation
ParameterMaterial input, material output, equipment, or parameter. The parameter_type column disambiguates between the four. Data parameters are just referred to as "parameters" in the UI.
Parameter planned valueThe expected value for a parameter for a particular procedure run
Parameter confirmation valueThe confirmed value for a parameter for a particular procedure run, filled in by the operator
Parameter measured valueThe measured value of a parameter during the course of executing a procedure

bnch$procedure_run$beta

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
study_idUnique identifier for the parent study of the procedure runForeign key for study.idstdy_iG0LW1XU
procedure_idUnique identifier for the template procedure that the procedure run was created fromCharacter Varyingpc_aX3ST2SH
workflow_task_idUnique identifier for associated Workflow taskForeign key for workflow_task.idwftask_gLZqJzcl
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived

bnch$procedure_method_exec_instance_assoc$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
source_procedure_method_execution_instance_idUnique identifier for source procedure method execution instanceCharacter Varyingpcmei_gLZqJzcl
target_procedure_method_execution_instance_idUnique identifier for target procedure method execution instanceCharacter Varyingpcmei_zsGLtpSo

bnch$procedure_method_execution_instance$beta

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
procedure_run_idUnique identifier for parent procedure runCharacter Varyingpcr_gLZqJzcl
workflow_task_idUnique identifier for associated Workflow taskForeign key for workflow_task.idwftask_gLZqJzcl
worksheet_idUnique identifier for associated worksheetForeign key for worksheet.idwks_gLZqJzcl
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived

bnch$procedure_method_task_transition$beta

Table rowDefinitionValue typeExamples values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
method_execution_instance_idUnique identifier for the associated method execution instanceForeign key for procedure_method_execution_instance.idpmei_hh9ffHqV
transitioned_atTime entered when the associated Workflow task was transitioned to the status specified in status_display_nameTimestamp without timezone2019-12-06T23:24:44.885478
status_display_nameStatus of Workflow task associated with the methodCharacter varyingIn progress, Failed, Skipped
commentComment, if any, associated with transitioning (starting, completing, skipping, or failing) the methodCharacter VaryingDelayed

bnch$procedure_step_execution_instance$beta

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_ hh9ffHqV
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
positionZero-indexed position of the step within a step groupInteger0, 1
step_group_typeType of the parent step groupCharacter VaryingPRE_RUN, RUN
workflow_task_idUnique identifier for associated Workflow taskForeign key for workflow_task.idwftask_gLZqJzcl
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived

bnch$parameter_planned_value$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of parent parameter in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
method_execution_instance_idUnique identifier for the execution instance of a method for a replicate of a conditionForeign key for procedure_method_execution_instance.idpcmei_Bz5Dlmu5Methods are referred to as “unit operations” in the Benchling UI
parameter_typeParameter type of the parent parameterCharacter VaryingEQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETERData parameters are referred to as “parameters” in the Benchling UI
parameter_idUnique identifier for the parent parameterCharacter Varyingpcparam_cCO8DvfcCan be used for queries across multiple executions of the same procedure
valueThe planned value for the parameterJSON value350, null, bfi_GuPYFZQH, water
typeData type of the parent parameter versionCharacter Varyingentity_link, text, float
unit_idUnique identifier for the unit associated with the parent parameter versionForeign key for unit.idnull, unit_aWP1Asqp
amountThe planned amount for a material input. Will always be null for other parameter types.Floating pointnull, 4.2
amount_unit_idUnique identifier for the amount unit for a material input. Will always be null for other parameter types.Foreign key for unit.idnull, unit_aWP1Asqp
container_id1Unique identifier for the associated containerForeign key for container.idnull, con_wQM2Lshs

bnch$parameter_confirmation_value$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of parent parameter in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
method_execution_instance_idUnique identifier for the execution instance of a method for a replicate of a conditionForeign key for procedure_method_execution_instance.idpcmei_Bz5Dlmu5Methods are referred to as “unit operations” in the Benchling UI
parameter_typeParameter type of the parent parameterCharacter VaryingEQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETERData parameters are referred to as “parameters” in the Benchling UI
parameter_idUnique identifier for the parent parameterCharacter Varyingpcparam_cCO8DvfcCan be used for queries across multiple executions of the same procedure
valueThe confirmed value for the parameterJSON value350, null, bfi_GuPYFZQH, water
typeData type of the parent parameter versionCharacter Varyingentity_link, text, float
unit_idUnique identifier for the unit associated with the parent parameter versionForeign key for unit.idnull, unit_aWP1Asqp
amountThe planned amount for a material input. Will always be null for other parameter types.Floating pointnull, 4.2
amount_unit_idUnique identifier for the amount unit for a material input. Will always be null for other parameter types.Foreign key for unit.idnull, unit_aWP1Asqp
container_id1Unique identifier for the associated containerForeign key for container.idnull, con_wQM2Lshs
recorded_atThe date/time that the parameter was confirmed, or for material inputs, was addedTimestamp without time zonenull, 2024-09-06T14:38:29
commentComment, if any, associated with the parameter confirmationCharacter VaryingUsing more saltBlank comments are stored as an empty string

bnch$parameter_measured_value$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of parent parameter in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
method_execution_instance_idUnique identifier for the execution instance of a method for a replicate of a conditionForeign key for procedure_method_execution_instance.idpcmei_Bz5Dlmu5Methods are referred to as “unit operations” in the Benchling UI
parameter_typeParameter type of the parent parameterCharacter VaryingEQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETERData parameters are referred to as “parameters” in the Benchling UI
parameter_idUnique identifier for the parent parameterCharacter Varyingpcparam_cCO8DvfcCan be used for queries across multiple executions of the same procedure
valueThe measured value for the parameterJSON value350, null, bfi_GuPYFZQH, water
typeData type of the parent parameter versionCharacter Varyingentity_link, text, float
unit_idUnique identifier for the unit associated with the parent parameter versionForeign key for unit.idnull, unit_aWP1Asqp
amountThe planned amount for a material input. Will always be null for other parameter types.Floating pointnull, 4.2
amount_unit_idUnique identifier for the amount unit for a material input. Will always be null for other parameter types.Foreign key for unit.idnull, unit_aWP1Asqp
container_id1Unique identifier for the associated containerForeign key for container.idnull, con_wQM2Lshs
recorded_atThe date/time that the parameter was confirmed, or for material inputs, was addedTimestamp without time zonenull, 2024-09-06T14:38:29
commentComment, if any, associated with the parameter confirmationCharacter VaryingUsing more saltBlank comments are stored as an empty string

bnch$parameter_value_plate_well$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
plate_idUnique identifier for the plateForeign key for plate.idplt_wQM2Lshs
parameter_confirmation_value_idUnique identifier a confirmed parameter valueForeign key for parameter_confirmation_value.idppvc_aWP1Asqp
parameter_planned_value_idUnique identifier a planned parameter valueForeign key for parameter_planned_value.idppvp_aWP1Asqp
well_positionPosition of the plate well where the parameter value was confirmedCharacter VaryingA3

bnch$procedure_run_condition$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
descriptionDescription of the conditionCharacter VaryingControl
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
procedure_run_idUnique identifier for the parent procedure runForeign key for procedure_run.idprc_wa2kjuQaQ

bnch$procedure_run_condition_replicate$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
condition_idUnique identifier for the parent conditionForeign key for procedure_run_condition.idpcrc_wa2kjuQaQ
replicate_numberUnique identifier for the replicate within the condition groupInteger1

bnch$procedure_method_condition_replicate$beta

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent yXrL3BjX, etr GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
procedure_run_condition_replicate_idUnique identifier for a specific replicate of a conditionForeign key for procedure_run_condition_replicate_idprcr_qHF3HNaT
method_execution_instance_idUnique identifier for the execution instance of a method (unit operation) for a replicate of a conditionForeign key for procedure_method_execution_instance.idpcmei_Bz5Dlmu5

--{Results Tables}--

assay_run_schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
parent_schema_idUnique identifier for schema which object is derived fromForeign key for schema.idts_XDQ0OW6s

assay_result_schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
parent_schema_idUnique identifier for schema which object is derived fromForeign key for schema.idts_XDQ0OW6s

EXAMPLE Result table

Applied filter(s): IS_NOT_ARCHIVED, STATIC_IS_REVIEWED, STATIC_IS_VALID

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
v3_idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableAPI identifier used in future versions of the Benchling API. May benullwhile in development.
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
schemaUnique Schema name for objectText"Fermentation Results"
created_at$Date created for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_at$Date object was modified in BenchlingTimestamp without timezone2019-12-08T22:34:55.174635
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
custom$Any custom created columns will be shown hereJSONBCustom Columns are created after a result table has been entered into a Notebook entry
entityThe Entity an object is mapped toForeign key for registry_entity.idbfi_cooUBrYb
entry_id$Unique identifier for EntryForeign key for entry.idetr_GtcscEZqSee Entry Table for more information
run_id$Unique identifier for EntryForeign key for run.ida11d82b2-8df3-44ae-bb2e-89086c8b69a4See Entry Table for more information
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
validation_status$Validation status for individual result objectVALID, INVALIDVALID, INVALID
validation_comment$Validation comment for individual result objectText"Standard curve failure"
field_validation$Validation comment for each field of the Result objectJSONB{"timestamp":{"validation_comment": null, "validation_status": "VALID"}, "fluorescence_rfu":{"validation_comment": null, "validation_status": "VALID"}, "entity":{"validation_comment": null, "validation_status": "VALID"}}
Speed(EXAMPLE)Individual field of Result objectFloating Point48.7Value dependent on field type.See field table for more information
Color(EXAMPLE)Individual field of Result objectText"Green"Value dependent on field type.See field table for more information
Resistance(EXAMPLE)Individual field of Result objectText["Ampicillin", "Streptomycin"]Value dependent on field type.See field table for more information
result_field(EXAMPLE)Individual field of Result objectValue dependent on field typeinteger, floating point, text, blob link, etcValue dependent on field type.See field table for more information

--{Registry Tables}--

entity_schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
entity_typeSelected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entryOligo schema are listed as dna_sequence types.See Schema table for more information
registry_idUnique identifier for an Organization's RegistryForeign Key for reigstry.idsrc_rdw6rOsL1 Registry per Organization
prefixPrefix selected for each schema objectText"p"Prefix will always come before Registry ID for registered objects
descriptionSchema description defined by the userText"Cell lines from project Aurelia. Please talk to the lab manager before using."There is a 1000 character limit on schema descriptions.

entity

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_idUnique Benchling Registry ID associated with each registered entityText"p001"
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
folder_idUnique identifier for folder containing objectForeign key for folder.idlib_J3tmt8BPIf object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_idUnique identifier for project containing objectForeign key for project.idsrc_PDSy77zEIf null, then object isn't contained within a project
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
typeSelected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entryOligo schema are listed as dna_sequence types
validation statusRegistration validation status of objectPASSED, FAILEDPASSED, FAILED
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
is_registereddenotes whether this object is registeredbooleanTrue

registration_origin

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableregistration_origin_bfi_EVf5Yd8rPrimary key for a table
source_idThe registryForeign key to registry.idsrc_hh9ffHqV
entity_idThe entityForeign key to entity.idbfi_EVf5Yd8r
registered_atTimestamp when entity was registeredTimestamp without timezone2023-07-26T21:46:53.670489
origin_entry_idUnique identifier for EntryForeign key to entry.idetr_EuoDTxy1

registry_entity

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_idUnique Benchling Registry ID associated with each registered entityText"p001"
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
folder_idUnique identifier for folder containing objectForeign key for folder.idlib_J3tmt8BPIf object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_idUnique identifier for project containing objectForeign key for project.idsrc_PDSy77zEIf null, then object isn't contained within a project
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
typeSelected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entry, rna_oligoOligo schema are listed as dna_sequence types
validation statusRegistration validation status of objectPASSED, FAILEDPASSED, FAILED
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit

entity_alias

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
entity_idThe entity for which this is an aliasForeign key for entity.ident_yXrL3BjX
aliasIdentifier serving as the entity aliasTextMy Memorable Alias

mixture_ingredient

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
created_at$Created date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_at$Most recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
mixture_idUnique ID for mixture objectForeign key for mixture.idbfi_gQMDFBm4
component_entity_idUnique identifier for entity objectForeign key for registry_entity.idbfi_cooUBrYb
amountAmount of contentFloating Point6, 6.87, 7799499.2359, etc
amount_textAmount as textCharacter Varying100 grams

mixture

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_idUnique Benchling Registry ID associated with each registered entityText"p001"
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
folder_idUnique identifier for folder containing objectForeign key for folder.idlib_J3tmt8BPIf object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_idUnique identifier for project containing objectForeign key for project.idsrc_PDSy77zEIf null, then object isn't contained within a project
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
typeSelected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entry, rna_oligoOligo schema are listed as dna_sequence types
validation statusRegistration validation status of objectPASSED, FAILEDPASSED, FAILED
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
is_registereddenotes whether this object is registeredbooleanTrue
amounthow much of the mixturedouble100
unitsunitsCharacter Varyinggrams
allows_measured_ingredientswhether you can have measured ingredients in this mixturebooleantrue

EXAMPLE Entity Table

Table RowDefinitionValue TypeExample values (if applicable)Notes
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
schemaUnique Schema name for objectText"Fermentation Results"
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
creator_id$Unique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_at$Created date for object (when the entity was originally created)Timestamp without timezone2019-12-06T23:24:44.885478
modified_at$Most recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
name$Name of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
file_registry_id$Unique Benchling Registry ID associated with each registered entityText"p001"
schema_id$Unique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
folder_id$Unique identifier for folder containing objectForeign key for folder.idlib_J3tmt8BPIf object not in folder, then folder_id = project_id.If null, then object not in folder/project
project_id$Unique identifier for project containing objectForeign key for project.idsrc_PDSy77zEIf null, then object isn't contained within a project
url$url for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
type$Selected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entry, rna_oligoOligo schema are listed as dna_sequence types
is_registered$Is entity currently registeredBooleanTrue, FalseTrue = Entity has been registered
Color(EXAMPLE)Individual Schema FieldText"green"Value dependent on field type.See field table for more information
Plasmid(EXAMPLE)Individual Schema Fieldforeign key for plasmid entityseq_HXnZhUkTValue dependent on field type.See field table for more information
Length(EXAMPLE)Individual Schema FieldFloating Point4.567Value dependent on field type.See field table for more information

batch_schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
registry_idUnique identifier for an Organization's RegistryForeign Key for reigstry.idsrc_rdw6rOsL1 Registry per Organization
entity_schema_idUnique identifier for schema objectForeign key for schema.idts_XDQ0OW6s

batch

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purposeArchival reason for object in BenchlingMade in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, OtherMade in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, OtherAvailable archive purpose options dependent on object
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
entity_idUnique identifier for entity objectForeign key for registry_entity.idbfi_cooUBrYb
concentration_siConcentration value for content - note that this is in SI units, not the original units created in the application.Floating Point6, 6.87, 7799499.2359, etc
concentration_display_unitsOriginal concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column.Concentration Unitsug/mL
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
typeSelected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entryOligo schema are listed as dna_sequence types

--{Sample Tracking / Inventory Tables}--

location_schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purposeArchival reason for object in BenchlingMade in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, OtherMade in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, OtherAvailable archive purpose options dependent on object
registry_idUnique identifier for an Organization's RegistryForeign Key for reigstry.idsrc_rdw6rOsL1 Registry per Organization
prefixPrefix selected for each schema objectText"p"Prefix will always come before Registry ID for registered objects

location

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purposeArchival reason for object in BenchlingMade in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, OtherMade in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, OtherAvailable archive purpose options dependent on object
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
barcodeDisplays benchling barcode of the objectText15MLFALCON006
location_idUnique ID for location that contains objectForeign key for location.idloc_Y2v8daz0

box

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
barcodeDisplays benchling barcode of the objectText15MLFALCON006
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
location_idUnique ID for location that contains objectForeign key for location.idloc_Y2v8daz0

plate

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqV
archived$Archival state for object in BenchlingBooleanTRUE, FALSE
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etc
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
barcodeDisplays benchling barcode of the objectText15MLFALCON006
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
location_idUnique ID for location that contains objectForeign key for location.idloc_Y2v8daz0

container

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
barcodeDisplays benchling barcode of the objectText15MLFALCON006
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
box_idUnique ID for box objectForeign key for box.idbox_oz4ZE0MN
location_idUnique ID for location that contains objectForeign key for location.idloc_Y2v8daz0
plate_idUnique ID for plate objectForeign key for plate.idplt_K9VZG06I
row_indexRow position where container is locatedinteger5, 7, 12, etcContainer specific-must be in box
column_indexColumn position where container is locatedinteger5, 7, 12, etcContainer specific-must be in box
volume_siVolume value for container content - note that this is in SI units, not the original units created in the application.Floating Point5, 7, 12, etc
volume_display_unitsOriginal volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column.Text for volume unitsmL, uL, nL, etc
checkout_statusIndicates whether the container is checked-out, reserved, or available.character varyingAVAILABLE, RESERVED, CHECKED_OUT
checkout_status_modified_atThe date the container was last checked out, reserved, or checked intimestamp without time zone2020-06-04T00:11:56.132400
checkout_assignee_team_idUnique ID for the team the container is checked out or reserved forcharacter varyingteam_oh5xGqrm, nullnull = checkout assignee is a user
checkout_assignee_user_idUnique ID for the user the container is checked out or reserved forcharacter varyingent_naLWig4, nullnull = checkout assignee is a team
restriction_statusNOT_APPLICABLE for fixed plate wells and RESTRICTED or UNRESTRICTED for other containerscharacter varyingRESTRICTED, UNRESTRICTED, NOT_APPLICABLE

container_content

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
batch_idUnique identifier for batch objectForeign key for batch.idbat_Gs8PtV0KWhat batch is in the container
container_idUnique ID for container objectForeign key for container.idcon_gQMDFBm4
entity_idUnique identifier for entity objectForeign key for registry_entity.idbfi_cooUBrYb
concentration_siConcentration value for content - note that this is in SI units, not the original units created in the application.Floating Point6, 6.87, 7799499.2359, etc
concentration_display_unitsOriginal concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column.Concentration Unitsug/mL

container_transfer

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
input_batch_idUnique ID for batch to be transferredForeign key for batch.idbat_Gs8PtV0KTransfer Table-related; not workflow related
input_container_idUnique ID for container that has entity/batch to be transferred toForeign key for container.idcon_gQMDFBm4Transfer Table-related; not workflow related
input_entity_idUnique ID for entity to be transferredForeign key for registry_entity.idbfi_cooUBrYbTransfer Table-related; not workflow related
output_container_idUnique ID for newly created containerForeign key for container.idcon_gQMDFBm4Transfer Table-related; not workflow related
volume_siVolume value for container content - note that this is in SI units, not the original units created in the application.Floating Point5, 7, 12, etc
volume_display_unitsOriginal volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column.Text for volume unitsmL, uL, nL, etc

sample_owner

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tablecharacter varyingcon_gQMDFBm4_ent_naLWig4C, con_gQMDFBm4_team_oh5xGqrm
container_idForeign key for container.idcharacter varyingcon_gQMDFBm4
team_idUnique ID for a team that is a sample owner for the containercharacter varyingteam_oh5xGqrm, nullnull = sample owner is a user
user_idUnique ID for a user who is a sample owner for the containercharacter varyingent_naLWig4C, nullnull = sample owner is a team

restricted_sample_party

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tablecharacter varyingcon_gQMDFBm4_ent_naLWig4C, con_gQMDFBm4_team_oh5xGqrm
container_idForeign key for container.idcharacter varyingcon_gQMDFBm4
team_idUnique ID for a team that is a sample owner for the containercharacter varyingteam_oh5xGqrm, nullnull = sample owner is a user
user_idUnique ID for a user who is a sample owner for the containercharacter varyingent_naLWig4C, nullnull = sample owner is a team

--{Request Tables}--

request_schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
parent_schema_idUnique identifier for schema which object is derived fromForeign key for schema.idts_XDQ0OW6s

request_assignee

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
request_idUnique identifier for the requestForeign key for request.idreq_qPtu1MSo
user_idUnique identifier for userForeign key for user.ident_yXrL3BjXSee User Table for more information
team_idUnique identifier for the assignee's teamForeign key for team.idteam_oh5xGqrm

request_fulfillment

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
request_idUnique identifier for the requestForeign key for request.idreq_qPtu1MSo
sample_group_idID of the schemas designated for the requestForeign key for schema.idts_gUQdTwR7ID's can be for containers, entities, or batches
request_task_idUnique identifier for a task within a requestForeign key for task.idreqtsk_2nzie5Io
entry_idUnique identifier for EntryForeign key for entry.idetr_GtcscEZqSee Entry Table for more information
workflow_idUnique identifier for workflow containing objectForeign key for workflow.idwfw_DMcZhu4A
statusStatus for a request(requestor)IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLEDIN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED

request_sample

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
request_idUnique identifier for the requestForeign key for request.idreq_qPtu1MSo
sample_group_idID of the schemas designated for the requestForeign key for schema.idts_gUQdTwR7ID's can be for containers, entities, or batches
batch_idUnique identifier for batch objectForeign key for batch.idbat_Gs8PtV0KWhat batch is in the container
entity_idUnique identifier for entity objectForeign key for registry_entity.idbfi_cooUBrYb
container_idUnique ID for container objectForeign key for container.idcon_gQMDFBm4
field_nameDisplay name for field on schemaText"Date Sequenced"
row_indexRow position where container is locatedinteger5, 7, 12, etcContainer specific-must be in box

EXAMPLE task

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
request_idUnique identifier for the requestForeign key for request.idreq_qPtu1MSo

EXAMPLE request

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
schemaUnique Schema name for objectText"Fermentation Results"
created_at$Date created for objectTimestamp without timezone2019-12-06T23:24:44.885478
status$Status for a request fulfillmentIN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLEDIN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
display_id$Display name for object in Benchlingprefix-unique numberrequest1, request2
url$url for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
scheduled_on$Date which the request is to be scheduled fordatetime1/8/20

--{Study Tables}--

Study (bnch$study)

Applied filter(s):IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableCharacter Varyingstdy_btFSmR0zPrimary key for a table
source_idThe id of the project that the object's permissions comes fromForeign key for project.idsrc_hh9ffHqV
nameName of the StudyCharacter VaryingParameter screen for BT-111, Testing stability of BT-142 using accelerated degradation, etc
design_entry_idThe id of the design entry for the studyForeign key for entry.idetr_Y3cmkCdx, nullOnly applicable to Custom Studies - will be null for other study types.
phaseThe study's phaseCharacter VaryingDESIGN, EXECUTION, COMPLETE
display_idDisplay name for object in BenchlingPrefix-unique numberCLIN1, ADT12, etc
descriptionDescription of the studyTextThree month stability study for example drug candidate
schema_idUnique identifier for schema which object is derived fromForeign key for study_schema.idstdysch_CfbbyrNX
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without timezone2024-08-20T14:53:15.458544
modified_atMost recent modified date for objectTimestamp without timezone2024-08-23T13:34:03.96262
archived$Archival state for object in BenchlingBooleanTrue, FalseTrue indicates the object is archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull indicates the object is not archived

Study Item (bnch$study_item)

This table is a “join” or “association” table that tracks the associations between various items (such as entities or containers) and Studies. In the Benchling application itself you won’t see these association objects listed anywhere. Instead, you see them on either end of the association. On an item like an entity you see the studies that it is associated with. On a study you see a list of items that have been associated with it.

For each row in this table, item_id and study_id will always be populated, and then depending on the item’s type, one of the various item-type-specific columns like entity_id will be populated, with the rest null. So if the item being associated is an entity, with the ID bfi_UVTa6PyJ, you will see bfi_UVTa6PyJ listed in both the item_id and entity_id columns for that row, and the other item-type-specific columns such as entry_id will be null for that row.

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablestdyitasn_d7LnbtQsFK7nEBXePrimary key for this table. This is the ID of the association record itself, not the ID of the associated item or study.
source_idThe id of the project that the study item’s permissions comes fromForeign key for project.idsrc_ZJ0kzmAm
item_idThe id of the item associated with the studyForeign key for table dependent on item typeetr_gLFsdk9K, wftask_68fZLY8W, etc
study_idThe id of the study that the item is associated withForeign key for bnch$study.idstdy_fBzbWXmN
analysis_idThe id of the study item, if the item is an analysisCharacter Varyingana_EoHIlnUD, nullDeveloper ID of the analysis. null if the item is not an analysis
box_idThe id of the study item, if the item is a boxForeign key for box.idbox_ePewYTZf, nullnull if the item is not a box
container_idThe id of the study item, if the item is a containerForeign key for container.idcon_ZjUDdMtk, nullnull if the item is not a container
dataset_idThe id of the study item, if the item is a datasetCharacter Varyingdataset_mTIt1shB, nullDeveloper ID of the dataset. null if the item is not a dataset
entity_idThe id of the study item, if the item is an entityForeign key for entity.idbfi_UVTa6PyJ, prtn_cIKy9MlJ, nullnull if the item is not an entity
entry_idThe id of the study item, if the item is an entryForeign key for entry.idetr_gLFsdk9K, nullnull if the item is not an entry
plate_idThe id of the study item, if the item is a plateForeign key for plate.idplt_5JHwKzwE, nullnull if the item is not a plate
request_v2_submission_idThe id of the study item, if the item is a requestForeign key for bnch$request_v2_submission$beta.idrqsm_uESZvYDN, nullnull if the item is not a request
test_order_idThe id of the study item, if the item is a test orderForeign key for bnch$test_order$beta.idtord_ftNuIhp3, nullnull if the item is not a test order
workflow_task_idThe id of the study item, if the item is a workflow taskForeign key for workflow_task.idwftask_m6jQuRAx, nullnull if the item is not a workflow task
worksheet_idThe id of the study item, if the item is a worksheetForeign key for bnch$worksheet$alpha.idwks_EVsCXlta, nullnull if the item is not a worksheet
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without time zone2020-06-04T00:11:56.132400
modified_atMost recent modified date for objectTimestamp without time zone2020-06-04T00:11:56.132400

Study Schema (bnch$study_schema)

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablestdysch_CfbbyrNXPrimary key for a table
schema_typeSchema type selected for schema of objectTextstudy
nameName of object in BenchlingCharacter varyingStability Study
system_nameName of warehouse table for this schemaCharacter varyingstability_study
prefixPrefix used for display IDs when creating studies from this schemaCharacter varyingADT, PDT, CLIN, etc
archived$Archival state for object in BenchlingBooleanTrue, FalseTrue indicates the object is archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull indicates the object is not archived

--{Workflow Tables}--

workflow

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
aliasUnique identifier for the workflow, based on prefix and sequential numberprefix-unique numberWF020
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
descriptionDescription given to objectText"Fermentation Workflow"
statusStatus for a request(requestor)IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLEDIN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
last_stage_completedName of last stage entry marked as completeText"Transformation"
last_stage_completed_atTimestamp of when status of last stage entry was marked as completeTimestamp without timezone2019-12-06T23:24:44.885478
workflow_template_version_idAPI ID of workflow template used to generate this workflowForeign key for workflow_template_version.idwfwtmplv_0MjnYgSk
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit

workflow_template

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc

workflow_template_version

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
versionVersion#for workflow templateInteger1,3 65, etcAuto-incremental when new workflow version is completed
workflow_template_idUnique ID for workflow TEMPLATEForeign key for workflow_template.idwfwtmpl_w6d11hNb

stage_run

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
stage_nameStage name in BenchlingText"Transfection"
entry_idUnique identifier for EntryForeign key for entry.idetr_GtcscEZqSee Entry Table for more information
workflow_idUnique identifier for workflow containing objectForeign key for workflow.idwfw_DMcZhu4A
statusStatus for a request(requestor)IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLEDIN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
exp_condition_valuesValues available for Stage Experimental ConditionsText"Condition": "2"

--{Schema Tables}--

schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
schema_typeSchema type selected for schema of objectTextentity, assay_result, assay_run, request, location, box, container, plate, batchSee Schema table for more information
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc

field_definition

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
positionField number in schemaInteger0, 1, 5, etc0 = 1st field.1 = 2nd field...etc
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
typeSelected type of entities for a schema objectdna_sequence, aa_sequence, custom_entity, entrydna_sequence, aa_sequence, custom_entity, entryOligo schema are listed as dna_sequence types
display_nameDisplay name of schema in BenchlingText"Cell Line"
numeric_minMinimum numeric value given for objectInteger0, 1, 5, etcprecision limited by number of significant figures
numeric_maxMaximum numeric value given for objectInteger0, 1, 5, etcprecision limited by number of significant figures
is_multiSingle or multi option identifierTRUE, FALSETRUE, FALSE
is_requiredIdentifier whether field is required or notTRUE, FALSETRUE, FALSE
dropdown_idunique id of dropdown tableForeign key for dropdown_id in the field definition tablesfs_ZVmOP8Eddropdown_id also found in the URL for the dropdown in the Registry settings page
target_schema_idID of target schema that points to the relationship linkForeign key for entity_schema.idts_XDQ0OW6s

[DEPRECATED] field

Applied filter(s): LINKED_FIELD_IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
schema_idUnique identifier for schema containing objectForeign key for schema.idts_IOGwR6u4
field_defiintion_idUnique id of field definition for object in tableForeign key for field_defition.idschema_field_42365See field_definition Table
field_nameDisplay name for field on schemaText"Date Sequenced"
batch_idUnique identifier for batch objectForeign key for batch.idbat_Gs8PtV0KWhat batch is in the container
box_idUnique ID for box objectForeign key for box.idbox_oz4ZE0MN
container_idUnique ID for container objectForeign key for container.idcon_gQMDFBm4
entry_idUnique identifier for EntryForeign key for entry.idetr_GtcscEZqSee Entry Table for more information
location_idUnique ID for location that contains objectForeign key for location.idloc_Y2v8daz0
plate_idUnique ID for plate objectForeign key for plate.idplt_K9VZG06I
registry_entity_idunique id of any registered entityForeign key for registry_entity.idbfi_cooUBrYb
request_idUnique identifier for the requestForeign key for request.idreq_qPtu1MSo
run_idUnique identifier for the runForeign key for assay_run.idmulti_a11d82b2-8df3-44ae-bb2e-89086c8b69a4_file
display_valueText value of identified fieldText"Amp"
blob_valueBlob link value in JSON format of identified fieldJSON value{id, name, url}Attached file can be found in Benchling
float_valueFloating point value of identified fieldFloating Point2, 4.56, 4334.6493, etc
date_valueDate format value of identified fielddatetime1/8/20
datetime_valueDate format with timestamp value of identified fieldTimestamp with timezone2019-12-05T19:15:00
integer_valueInteger value of identified fieldInteger1, 2, 54, etc
json_valueJSON value of identified fieldJSON Value
linked_batch_idUnique id of any batch the field object is linked toForeign key for batch.idbat_Gs8PtV0K
linked_box_idUnique id of any box the field object is linked toForeign key for box.idbox_oz4ZE0MN
linked_container_idUnique id of any container the field object is linked toForeign key for container.idcon_gQMDFBm4
linked_entry_idUnique id of any entry the field object is linked toForeign key for entry.idetr_GtcscEZq
linked_location_idUnique id of any location the field object is linked toForeign key for location.idloc_Y2v8daz0
linked_plate_idUnique id of any plate the field object is linked toForeign key for plate.idplt_S5ALalNc
linked_result_idUnique id of any result the field object is linked toForeign key for result.id6498dd5a-1b4b-4954-826f-bfcfd1496373
linked_run_idUnique id of any run the field object is linked toForeign key for run.id343494f6-e633-4523-9aa6-26898c99f482
linked_registry_entity_idUnique id of any registered entity the field object is linked ooForeign key for registry_entity.idbfi_cooUBrYb
value_indexThe position number of a given value for a field that supports multiple valuesInteger(or null)null, 1, 2, 6, etc"null" = Not Multiselect.1,2,3,4, etc = Position of multi-select field

dropdown

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableCharacter Varyingsfs_jBu9uUnv, etc.Primary key for a table
nameName of dropdown in BenchlingCharacter VaryingColor, Analytes, etc.
archived$Archival state for dropdown in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for dropdown in BenchlingCharacter Varyingnull, Made in Error, Retired, Other, etcnull = object not archived

dropdown_option

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableCharacter Varyingsfso_2v93jfF9, etc.Primary key for a table
dropdown_idReference to parent dropdown IDCharacter Varyingsfs_jBu9uUnv, etc.Refers to dropdown.id
nameName of dropdown option in BenchlingCharacter VaryingColor, Analytes, etc.
positionRelative position of dropdown option in the dropdownInteger0, 3, etc.Ranges from 0 to (# options in dropdown - 1)
archived$Archival state for dropdown option in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for dropdown option in BenchlingCharacter Varyingnull, Made in Error, Retired, Other, etcnull = object not archived

--{Folder / Project Tables}--

project

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
urlurl for each object in BenchlingBrowser URLhttps://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit

folder

Applied filter(s): IS_NOT_ARCHIVED

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
archived$Archival state for object in BenchlingBooleanTRUE, FALSEtrue = object archived
archive_purpose$Archival reason for object in BenchlingTextnull, Made in Error, Retired, Other, etcnull = object not archived
created_atCreated date for objectTimestamp without timezone2019-12-06T23:24:44.885478
modified_atMost recent modified date for objectTimestamp without timezone2019-12-06T23:24:44.885478
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
parent_folder_idUnique identifier for folder containing objectForeign key for folder.idlib_J3tmt8BP

--{User Tables}--

principal

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
handleUnique username chosen by individual users or username defined for a Benchling AppsText"ssiegfried"Handle can be changed at any point to any other unique string of text/integers
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
emailUnique email associated with each user account , column will be null for Benchling App accountsEmail"[email protected]"
is_suspendedSuspension status for each user or appFALSE, TRUEFALSE, TRUETRUE = Suspended user
created_atCreated date for user or appTimestamp without timezone2019-12-06T23:24:44.885478

user

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
handleUnique username chosen by individual usersText"ssiegfried"Handle can be changed at any point to any other unique string of text/integers
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
emailUnique email associated with each user accountEmail"[email protected]"
is_suspendedSuspension status for each userFALSE, TRUEFALSE, TRUETRUE = Suspended user
created_atCreated date for userTimestamp without timezone2019-12-06T23:24:44.885478

team_member

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
team_idUnique identifier for the assignee's teamForeign key for team.idteam_oh5xGqrm
user_idUnique identifier for userForeign key for user.ident_yXrL3BjXSee User Table for more information
roleTeam membership status for an individual userADMIN, MEMBERADMIN, MEMBER

team

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
nameName of object in BenchlingCharacter VaryingTransfection Entry, QC Results, Therapeutic Cell Line, etc
descriptionDescription given to objectText"Fermentation Workflow"

--{Molecular Biology Tables}--

Note: These tables exist only in their $raw form; consider performing a JOIN on the relevant schema table.

DNA Sequnce$raw

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
nameUnique identifier for the requestCharacter VaryingTransfection Entry, Therapeutic Cell Line
basesA string representing the bases that make up the DNA SequenceCharacter Varying

agtctgttgggatggccacttaccacatcgtaccccta

[...]

bases_length_exceeds_limit

Whether or not the length of the

bases

field exceeds the limit

Booleanfalse

DNA Oligo$raw

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etcPrimary key for a table
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqVIf an object isn't in a project, the permissions will be derived from the Registry
nameUnique identifier for the requestCharacter VaryingTransfection Entry, Therapeutic Cell Line
basesA string representing the bases that make up the DNA OligoCharacter Varying

agtctgttgggatggccacttaccacatcgtaccccta

[...]

--{Workflow Tables}--

Workflow Task Group

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableprs_hVI52tJk
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqV
nameName of object in BenchlingCharacter varyingAnalytical SEC 26
display_idUnique identifier surfaced in the actual Benchling sitePrefix-unique numberSEC26
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without time zone2020-06-04T00:11:56.132400
modified_atMost recent modified date for objectTimestamp without time zone2020-06-04T00:11:56.132400
urlURL for each object in BenchlingBrowser URLhttps://demo.benchling.com/demo/f/lib_LDMZLtYM-media-prep/prs_hVI52tJk--analytical-sec-26/edit
folder_idUnique identifier for folder containing objectForeign key for folder.idlib_LDMZLtYM
execution_typeSelected type for how tasks are executedENTRY, DIRECTENTRY, DIRECT
archived$Archival state for object in BenchlingbooleanFALSE, TRUE
archive_purpose$Archival reason for object in BenchlingCharacter varyingnull, Made in Error, Retired, Other, etc
workflow_flowchart_node_config_idUnique identifier for workflow_flowchart_node_configForeign key for workflow_flowchart_node_config.idwffcnc_giVNQcTL
workflow_flowchart_config_version_idUnique identifier for workflow_flowchart_config_versionForeign key for workflow_flowchart_config_version.idwffccv_giVNQcAF

Workflow Task Schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableprstsch_0JAxhOhS
schema_typeSchema type selected for schema of objectTextworkflow_taskAlways workflow_task for this table
nameName of object in BenchlingCharacter varyingAnalytical SEC
system_nameName of warehouse table for this schemaCharacter varyinganalytical_sec
execution_typeSelected type for how tasks are executedENTRY, DIRECTENTRY, DIRECT
prefixPrefix used when creating workflow tasks from this schemaCharacter varyingSEC
workflow_task_group_prefixPrefix used when creating workflow task groups from this schemaCharacter varyingSEC
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without time zone2020-06-04T00:11:56.132400
modified_atMost recent modified date for objectTimestamp without time zone2020-06-04T00:11:56.132400
urlURL for each object in BenchlingBrowser URLhttps://demo.benchling.com/demo/f/lib_LDMZLtYM-media-prep/prs_hVI52tJk--analytical-sec-26/edit
can_set_assignee_on_task_creationDetermines if assignees can be set when a task is createdBooleanTRUE, FALSE
folder_idUnique identifier for folder containing objectForeign key for folder.idlib_LDMZLtYM
workflow_task_status_lifecycle_idUnique identifier for workflow_task_status_lifecycleForeign key for workflow_task_status_lifecycle.idprstswf_J8s40D7l
default_responsible_team_idUnique identifier for teamForeign key for team.idteam_oh5xGqrm
default_creation_folder_idUnique identifier for default folder where tasks of this schema are createdForeign key for folder.idlib_LDMZLtYM
default_entry_execution_folder_idUnique identifier for default folder where tasks of this schema are executedForeign key for folder.idlib_LDMZLtYM
archived$Archival state for object in BenchlingbooleanFALSE, TRUE
archive_purpose$Archival reason for object in BenchlingCharacter varyingnull, Made in Error, Retired, Other, etc

Workflow Task

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewftask_hVI52tJk
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqV
display_idUnique identifier surfaced in the actual Benchling sitePrefix-unique numberSEC26-T5
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without time zone2020-06-04T00:11:56.132400
modified_atMost recent modified date for objectTimestamp without time zone2020-06-04T00:11:56.132400
scheduled_on_dateDate the task is scheduled to be performedDate2020-06-04
assignee_idUnique identifier for assigned userForeign key for user.ident_yXrL3BjX
workflow_task_group_idUnique identifier for workflow_task_groupForeign key for workflow_task_group.idprs_hVI52tJk
workflow_task_schema_idUnique identifier for workflow_task_schemaForeign key for workflow_task_schema.idprstsch_0JAxhOhS
workflow_task_status_idUnique identifier for workflow_task_statusForeign key for workflow_task_status.idwfts_A6CmVrOp
execution_entry_idUnique identifier for entryForeign key for entry.idetr_GtcscEZq
execution_user_idUnique identifier for userForeign key for user.ident_yXrL3BjX
executed_onDate the task was executedTimestamp without time zone2020-06-04T00:11:56.132400
archived$Archival state for object in BenchlingBooleanFALSE, TRUE
archive_purpose$Archival reason for object in BenchlingCharacter varyingnull, Made in Error, Retired, Other, etc
workflow_flowchart_idUnique identifier for workflow_flowchartForeign key for workflow_flowchart.idwffc_giVNQcAF
workflow_flowchart_task_idUnique identifier for a flowchart workflow_taskForeign key for workflow_task.idwftask_OnnsW08k

Workflow Output Schema

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableprsosch_kz6y7T4o
schema_typeSchema type selected for schema of objectTextworkflow_outputAlways workflow_output for this table
nameName of object in BenchlingCharacter varyingAnalytical SEC
system_nameName of warehouse table for this schemaCharacter varyinganalytical_sec
prefixPrefix used when creating workflow tasks from this schemaCharacter varyingSEC
archived$Archival state for object in BenchlingbooleanFALSE, TRUE
archive_purpose$Archival reason for object in BenchlingCharacter varyingnull, Made in Error, Retired, Other, etc

Workflow Output

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewftask_hVI52tJk
source_idThe project or registry that the object's permissions comes fromForeign key for project.id or registry.idsrc_hh9ffHqV
display_idUnique identifier surfaced in the actual Benchling sitePrefix-unique numberSEC26-T5
creator_idUnique identifier for creator of objectForeign key for user.ident_yXrL3BjX
created_atCreated date for objectTimestamp without time zone2020-06-04T00:11:56.132400
modified_atMost recent modified date for objectTimestamp without time zone2020-06-04T00:11:56.132400
workflow_task_group_idUnique identifier for workflow_task_groupForeign key for workflow_task_group.idprs_hVI52tJk
workflow_task_idUnique identifier for workflow_task that output is forForeign key for workflow_task.idwftask_hVI52tJk
workflow_task_status_idUnique identifier for workflow_task_statusForeign key for workflow_task_status.idwfts_A6CmVrOp
workflow_output_schema_idUnique identifier for workflow_output_schemaForeign key for workflow_output_schema.idprsosch_kz6y7T4o
archived$Archival state for object in BenchlingbooleanFALSE, TRUE
archive_purpose$Archival reason for object in BenchlingCharacter varyingnull, Made in Error, Retired, Other, etc

Workflow Task Status

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewfts_A6CmVrOp
display_nameName of object in BenchlingCharacter varyingCompleted
status_typeType of statusPENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALIDPENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID

Workflow Task Status Lifecycle

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableprstswf_J8s40D7l
nameName of object in BenchlingCharacter varyingEntry Review
schema_execution_typeType of execution for task schemas using this lifecycleDIRECT, ENTRYDIRECT, ENTRY
initial_workflow_task_status_idUnique identifier for workflow_task_statusForeign key for workflow_task_status.idwfts_A6CmVrOpThe first status of the lifecycle.lifecycle edges determine the rest of the status order.

Workflow Task Status Lifecycle Edge

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tableprstswfe_aziohrUt
workflow_task_status_lifecycle_idUnique identifier for workflow_task_status_lifecycleForeign key for workflow_task_status_lifecycle.idprstswf_J8s40D7lLifecycle that the edge is for
from_workflow_task_status_idUnique identifier for workflow_task_statusForeign key for workflow_task_status.idwfts_A6CmVrOpThe starting status of the edge
to_workflow_task_status_idUnique identifier for workflow_task_statusForeign key for workflow_task_status.idwfts_Td7q3eiMThe ending status of the edge

Workflow Flowchart

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewffc_giVNQcAF

Workflow Flowchart Node Config

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewffcnc_giVNQWcXS
workflow_task_schema_idUnique identifier for workflow_task_schemaForeign key for workflow_task_schema.idprstsch_OnnsV06w

Workflow Flowchart Edge Config

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewffcec_poVNQcQE
workflow_flowchart_idUnique identifier for workflow_flowchartForeign key for workflow_flowchart.idwffc_giVNQcAF
from_flowchart_node_config_idUnique identifier for workflow_flowchart_node_configForeign key for workflow_flowchart_node_config.idwffcnc_mcMKcXS
to_node_config_idUnique identifier for workflow_flowchart_node_configForeign key for workflow_flowchart_node_config.idwffcnc_nwICpoe

Workflow Lineage Edge

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewfle_kmQWplX
to_workflow_task_idUnique identifier for workflow_taskForeign key for workflow_task.idwftask_OnnsW08k
from_workflow_task_idUnique identifier for workflow_taskForeign key for workflow_task.idwftask_OnnsW08k
to_workflow_output_idUnique identifier for workflow_outputForeign key for workflow_outputwfout_5cJLQKVF
from_workflow_output_idUnique identifier for workflow_outputForeign key for workflow_output.idwfout_5cJLQKVF

Workflow Flowchart Config Version

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewffccv_giVNQcAF
workflow_flowchart_config_idUnique identifier for workflow_flowchart_configForeign key for workflow_flowchart_config.idwffcc_wcIJAPL
workflow_flowchart_idUnique identifier for workflow_flowchartForeign key for workflow_flowchart.idwffc_giVNQcAF

Workflow Chart Config

Table RowDefinitionValue TypeExample values (if applicable)Notes
idUnique Benchling-prescribed ID for each line item in tableFormat dependent on tablewffcc_wcIJAPL
workflow_task_schema_idUnique identifier for workflow_task_schemaForeign key for workflow_task_schema.idprstsch_OnnsV06w