Note that this page doesn't display tables as well as we'd hope. Please zoom in your browser with CTRL-+ or CMD-+.
Each Benchling Warehouse (WH) table has many columns that represent the data contained in each table. Use the following information help understand how each table can be used to directly query the data you have stored in Benchling.
To see all Benchling Tables in diagram format please navigate to https://docs.benchling.com/docs/warehouse-tables-v2
The following information is outlined below for every WH table:
Column Name
Column Definition
Value Type
Example Values
Useful Notes
📘 Tables vs. $raw
tables
As discussed in Warehouse Tables , these tables are Postgres views that represent a "cleaned up" version of the raw data. For applicable tables, we've specified the filter(s) being applied to the raw data in order to produce the cleaned table. These filters are described here:
Filter key Filter description IS_NOT_ARCHIVED
Filters away rows where the archived$
column is True
LINKED_FIELD_IS_NOT_ARCHIVED
Filters away rows in the field table where the corresponding row in the field_definition table's archived$
column is True
. This look up is an outer join on field.field_definition_id = field_definition.id
STATIC_IS_REVIEWED
Performs a join between the entry$raw
table and the result table (result.entry_id = entry.id
). Filters away rows whose corresponding entry IS NOT accepted (entry$raw.review_status != ACCEPTED
) STATIC_IS_VALID
Filters away result rows where validation_status
IS NOT NULL AND the value is not VALID
or PARTIALLY_VALID
.
See below for all tables relating to the Benchling Notebook
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Primary key for a Warehouse table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Format dependent on table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 display_id Unique identifier surfaced in the actual Benchling site prefix-unique entry number EXP001 or EXP20000416 I.E Unique Entry number folder_id Unique identifier for folder containing object Foreign key for folder.id lib_J3tmt8BP If object not in folder, then folder_id = project_id. If null, then object not in folder/project workflow_id Unique identifier for workflow containing object Foreign key for workflow.id wfw_DMcZhu4A schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 review_status Current review status for object null, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED null, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED review_requested_at Date of most recent review requested for object Timestamp without timezone 2019-12-06T23:24:44.885478 Date of most recent review request review_status_changed_at Date of review status change for object Timestamp without timezone 2019-12-06T23:24:44.885478 url url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry user_id Unique identifier for user Foreign key for user.id ent_yXrL3BjX See User Table for more information entry_id Unique identifier for Entry Foreign key for entry.id etr_GtcscEZq See Entry Table for more information
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry user_id Unique identifier for user Foreign key for user.id ent_yXrL3BjX See User Table for more information entry_id Unique identifier for Entry Foreign key for entry.id etr_GtcscEZq If entry has multiple authors there will be multiple rows per entry_id. See Entry Table for more information
Table Row Definition Value Type Example values (if applicable) Notes id identifier of the run Character varying ee6da040-fa64-4e47-9a5e-98892fa32580 source_id project that the run is in Character varying src_RWL0Oekn schema lab auto schema this run is part of Character varying transfection_v1_schema created_at$ when the run was created timestamp without time zone 2020-06-04T00:11:56.132400 creator_id$ who created it Character varying ent_naLWig4C entry_id$ which entry it was created in Character varying etr_nLrUvmPx archived$ whether the run was archived boolean false archive_purpose$ reason for why the run was archived, if archived Character varying null validation_status$ validation status Character varying VALID validation_comment$ validation information Character varying null plate custom created columns as part of the run configuration Character varying "plt_2Q09VfYn"
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc parent_schema_id Unique identifier for schema which object is derived from Foreign key for schema.id ts_XDQ0OW6s
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc parent_schema_id Unique identifier for schema which object is derived from Foreign key for schema.id ts_XDQ0OW6s
Applied filter(s): IS_NOT_ARCHIVED
, STATIC_IS_REVIEWED
, STATIC_IS_VALID
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry schema Unique Schema name for object Text "Fermentation Results" created_at$ Date created for object Timestamp without timezone 2019-12-06T23:24:44.885478 archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived custom$ Any custom created columns will be shown here JSONB {} Custom Columns are created after a result table has been entered into a Notebook entry entity The Entity an object is mapped to Foreign key for registry_entity.id bfi_cooUBrYb entry_id$ Unique identifier for Entry Foreign key for entry.id etr_GtcscEZq See Entry Table for more information run_id$ Unique identifier for Entry Foreign key for run.id a11d82b2-8df3-44ae-bb2e-89086c8b69a4 See Entry Table for more information creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX validation_status$ Validation status for individual result object VALID, INVALID VALID, INVALID validation_comment$ Validation comment for individual result object Text "Standard curve failure" field_validation$ Validation comment for each field of the Result object JSONB { "timestamp": { "validation_comment": null, "validation_status": "VALID" }, "fluorescence_rfu": { "validation_comment": null, "validation_status": "VALID" }, "entity": { "validation_comment": null, "validation_status": "VALID" } } Speed (EXAMPLE) Individual field of Result object Floating Point 48.7 Value dependent on field type. See field table for more information Color (EXAMPLE) Individual field of Result object Text "Green" Value dependent on field type. See field table for more information Resistance (EXAMPLE) Individual field of Result object Text ["Ampicillin", "Streptomycin"] Value dependent on field type. See field table for more information result_field (EXAMPLE) Individual field of Result object Value dependent on field type integer, floating point, text, blob link, etc Value dependent on field type. See field table for more information
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived entity_type Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry Oligo schema are listed as dna_sequence types. See Schema table for more information registry_id Unique identifier for an Organization's Registry Foreign Key for reigstry.id src_rdw6rOsL 1 Registry per Organization prefix Prefix selected for each schema object Text "p" Prefix will always come before Registry ID for registered objects
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc file_registry_id Unique Benchling Registry ID associated with each registered entity Text "p001" creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object (when the entity was originally created) Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 folder_id Unique identifier for folder containing object Foreign key for folder.id lib_J3tmt8BP If object not in folder, then folder_id = project_id. If null, then object not in folder/project project_id Unique identifier for project containing object Foreign key for project.id src_PDSy77zE If null, then object isn't contained within a project modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 type Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry Oligo schema are listed as dna_sequence types validation status Registration validation status of object PASSED, FAILED PASSED, FAILED url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit is_registered denotes whether this object is registered boolean True
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc file_registry_id Unique Benchling Registry ID associated with each registered entity Text "p001" creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object (when the entity was originally created) Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 folder_id Unique identifier for folder containing object Foreign key for folder.id lib_J3tmt8BP If object not in folder, then folder_id = project_id. If null, then object not in folder/project project_id Unique identifier for project containing object Foreign key for project.id src_PDSy77zE If null, then object isn't contained within a project modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 type Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry, rna_oligo Oligo schema are listed as dna_sequence types validation status Registration validation status of object PASSED, FAILED PASSED, FAILED url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry entity_id The entity for which this is an alias Foreign key for entity.id ent_yXrL3BjX alias Identifier serving as the entity alias Text My Memorable Alias
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry created_at$ Created date for object (when the entity was originally created) Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at$ Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 mixture_id Unique ID for mixture object Foreign key for mixture.id bfi_gQMDFBm4 component_entity_id Unique identifier for entity object Foreign key for registry_entity.id bfi_cooUBrYb amount Amount of content Floating Point 6, 6.87, 7799499.2359, etc amount_text Amount as text Character Varying 100 grams
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc file_registry_id Unique Benchling Registry ID associated with each registered entity Text "p001" creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object (when the entity was originally created) Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 folder_id Unique identifier for folder containing object Foreign key for folder.id lib_J3tmt8BP If object not in folder, then folder_id = project_id. If null, then object not in folder/project project_id Unique identifier for project containing object Foreign key for project.id src_PDSy77zE If null, then object isn't contained within a project modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 type Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry, rna_oligo Oligo schema are listed as dna_sequence types validation status Registration validation status of object PASSED, FAILED PASSED, FAILED url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit is_registered denotes whether this object is registered boolean True amount how much of the mixture double 100 units units Character Varying grams allows_measured_ingredients whether you can have measured ingredients in this mixture boolean true
Table Row Definition Value Type Example values (if applicable) Notes source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry schema Unique Schema name for object Text "Fermentation Results" archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived creator_id$ Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at$ Created date for object (when the entity was originally created) Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at$ Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 name$ Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc file_registry_id$ Unique Benchling Registry ID associated with each registered entity Text "p001" schema_id$ Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 folder_id$ Unique identifier for folder containing object Foreign key for folder.id lib_J3tmt8BP If object not in folder, then folder_id = project_id. If null, then object not in folder/project project_id$ Unique identifier for project containing object Foreign key for project.id src_PDSy77zE If null, then object isn't contained within a project url$ url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit type$ Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry, rna_oligo Oligo schema are listed as dna_sequence types is_registered$ Is entity currently registered Boolean True, False True = Entity has been registered Color (EXAMPLE) Individual Schema Field Text "green" Value dependent on field type. See field table for more information Plasmid (EXAMPLE) Individual Schema Field foreign key for plasmid entity seq_HXnZhUkT Value dependent on field type. See field table for more information Length (EXAMPLE) Individual Schema Field Floating Point 4.567 Value dependent on field type. See field table for more information
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived registry_id Unique identifier for an Organization's Registry Foreign Key for reigstry.id src_rdw6rOsL 1 Registry per Organization entity_schema_id Unique identifier for schema object Foreign key for schema.id ts_XDQ0OW6s
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose Archival reason for object in Benchling Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other Available archive purpose options dependent on object name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 entity_id Unique identifier for entity object Foreign key for registry_entity.id bfi_cooUBrYb concentration_si Concentration value for content - note that this is in SI units, not the original units created in the application. Floating Point 6, 6.87, 7799499.2359, etc concentration_display_units Original concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column. Concentration Units ug/mL url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit type Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry Oligo schema are listed as dna_sequence types
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose Archival reason for object in Benchling Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other Available archive purpose options dependent on object registry_id Unique identifier for an Organization's Registry Foreign Key for reigstry.id src_rdw6rOsL 1 Registry per Organization prefix Prefix selected for each schema object Text "p" Prefix will always come before Registry ID for registered objects
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose Archival reason for object in Benchling Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other Available archive purpose options dependent on object name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 barcode Displays benchling barcode of the object Text 15MLFALCON006 location_id Unique ID for location that contains object Foreign key for location.id loc_Y2v8daz0
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 barcode Displays benchling barcode of the object Text 15MLFALCON006 url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit location_id Unique ID for location that contains object Foreign key for location.id loc_Y2v8daz0
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV archived$ Archival state for object in Benchling Boolean TRUE, FALSE archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 barcode Displays benchling barcode of the object Text 15MLFALCON006 url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit location_id Unique ID for location that contains object Foreign key for location.id loc_Y2v8daz0
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 barcode Displays benchling barcode of the object Text 15MLFALCON006 url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit box_id Unique ID for box object Foreign key for box.id box_oz4ZE0MN location_id Unique ID for location that contains object Foreign key for location.id loc_Y2v8daz0 plate_id Unique ID for plate object Foreign key for plate.id plt_K9VZG06I row_index Row position where container is located integer 5, 7, 12, etc Container specific - must be in box column_index Column position where container is located integer 5, 7, 12, etc Container specific - must be in box volume_si Volume value for container content - note that this is in SI units, not the original units created in the application. Floating Point 5, 7, 12, etc volume_display_units Original volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column. Text for volume units mL, uL, nL, etc
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry batch_id Unique identifier for batch object Foreign key for batch.id bat_Gs8PtV0K What batch is in the container container_id Unique ID for container object Foreign key for container.id con_gQMDFBm4 entity_id Unique identifier for entity object Foreign key for registry_entity.id bfi_cooUBrYb concentration_si Concentration value for content - note that this is in SI units, not the original units created in the application. Floating Point 6, 6.87, 7799499.2359, etc concentration_display_units Original concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column. Concentration Units ug/mL
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry input_batch_id Unique ID for batch to be transferred Foreign key for batch.id bat_Gs8PtV0K Transfer Table-related; not workflow related input_container_id Unique ID for container that has entity/batch to be transferred to Foreign key for container.id con_gQMDFBm4 Transfer Table-related; not workflow related input_entity_id Unique ID for entity to be transferred Foreign key for registry_entity.id bfi_cooUBrYb Transfer Table-related; not workflow related output_container_id Unique ID for newly created container Foreign key for container.id con_gQMDFBm4 Transfer Table-related; not workflow related volume_si Volume value for container content - note that this is in SI units, not the original units created in the application. Floating Point 5, 7, 12, etc volume_display_units Original volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column. Text for volume units mL, uL, nL, etc
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc parent_schema_id Unique identifier for schema which object is derived from Foreign key for schema.id ts_XDQ0OW6s
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry request_id Unique identifier for the request Foreign key for request.id req_qPtu1MSo user_id Unique identifier for user Foreign key for user.id ent_yXrL3BjX See User Table for more information team_id Unique identifier for the assignee's team Foreign key for team.id team_oh5xGqrm
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 request_id Unique identifier for the request Foreign key for request.id req_qPtu1MSo sample_group_id ID of the schemas designated for the request Foreign key for schema.id ts_gUQdTwR7 ID's can be for containers, entities, or batches request_task_id Unique identifier for a task within a request Foreign key for task.id reqtsk_2nzie5Io entry_id Unique identifier for Entry Foreign key for entry.id etr_GtcscEZq See Entry Table for more information workflow_id Unique identifier for workflow containing object Foreign key for workflow.id wfw_DMcZhu4A status Status for a request (requestor) IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry request_id Unique identifier for the request Foreign key for request.id req_qPtu1MSo sample_group_id ID of the schemas designated for the request Foreign key for schema.id ts_gUQdTwR7 ID's can be for containers, entities, or batches batch_id Unique identifier for batch object Foreign key for batch.id bat_Gs8PtV0K What batch is in the container entity_id Unique identifier for entity object Foreign key for registry_entity.id bfi_cooUBrYb container_id Unique ID for container object Foreign key for container.id con_gQMDFBm4 field_name Display name for field on schema Text "Date Sequenced" row_index Row position where container is located integer 5, 7, 12, etc Container specific - must be in box
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry request_id Unique identifier for the request Foreign key for request.id req_qPtu1MSo
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry schema Unique Schema name for object Text "Fermentation Results" created_at$ Date created for object Timestamp without timezone 2019-12-06T23:24:44.885478 status$ Status for a request fulfillment IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED display_id$ Display name for object in Benchling prefix-unique number request1, request2 url$ url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit scheduled_on$ Date which the request is to be scheduled for datetime 1/8/20
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry alias Unique identifier for the workflow, based on prefix and sequential number prefix-unique number WF020 name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 description Description given to object Text "Fermentation Workflow" status Status for a request (requestor) IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED last_stage_completed Name of last stage entry marked as complete Text "Transformation" last_stage_completed_at Timestamp of when status of last stage entry was marked as complete Timestamp without timezone 2019-12-06T23:24:44.885478 workflow_template_version_id API ID of workflow template used to generate this workflow Foreign key for workflow_template_version.id wfwtmplv_0MjnYgSk url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table version Version # for workflow template Integer 1,3 65, etc Auto-incremental when new workflow version is completed workflow_template_id Unique ID for workflow TEMPLATE Foreign key for workflow_template.id wfwtmpl_w6d11hNb
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 stage_name Stage name in Benchling Text "Transfection" entry_id Unique identifier for Entry Foreign key for entry.id etr_GtcscEZq See Entry Table for more information workflow_id Unique identifier for workflow containing object Foreign key for workflow.id wfw_DMcZhu4A status Status for a request (requestor) IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED exp_condition_values Values available for Stage Experimental Conditions Text "Condition": "2"
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table schema_type Schema type selected for schema of object Text entity, assay_result, assay_run, request, location, box, container, plate, batch See Schema table for more information name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 position Field number in schema Integer 0, 1, 5, etc 0 = 1st field. 1 = 2nd field...etc name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc type Selected type of entities for a schema object dna_sequence, aa_sequence, custom_entity, entry dna_sequence, aa_sequence, custom_entity, entry Oligo schema are listed as dna_sequence types display_name Display name of schema in Benchling Text "Cell Line" numeric_min Minimum numeric value given for object Integer 0, 1, 5, etc precision limited by number of significant figures numeric_max Maximum numeric value given for object Integer 0, 1, 5, etc precision limited by number of significant figures is_multi Single or multi option identifier TRUE, FALSE TRUE, FALSE is_required Identifier whether field is required or not TRUE, FALSE TRUE, FALSE dropdown_id unique id of dropdown table Foreign key for dropdown_id in the field definition table sfs_ZVmOP8Ed dropdown_id also found in the URL for the dropdown in the Registry settings page target_schema_id ID of target schema that points to the relationship link Foreign key for entity_schema.id ts_XDQ0OW6s
Applied filter(s): LINKED_FIELD_IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry schema_id Unique identifier for schema containing object Foreign key for schema.id ts_IOGwR6u4 field_defiintion_id Unique id of field definition for object in table Foreign key for field_defition.id schema_field_42365 See field_definition Table field_name Display name for field on schema Text "Date Sequenced" batch_id Unique identifier for batch object Foreign key for batch.id bat_Gs8PtV0K What batch is in the container box_id Unique ID for box object Foreign key for box.id box_oz4ZE0MN container_id Unique ID for container object Foreign key for container.id con_gQMDFBm4 entry_id Unique identifier for Entry Foreign key for entry.id etr_GtcscEZq See Entry Table for more information location_id Unique ID for location that contains object Foreign key for location.id loc_Y2v8daz0 plate_id Unique ID for plate object Foreign key for plate.id plt_K9VZG06I registry_entity_id unique id of any registered entity Foreign key for registry_entity.id bfi_cooUBrYb request_id Unique identifier for the request Foreign key for request.id req_qPtu1MSo run_id Unique identifier for the run Foreign key for assay_run.id multi_a11d82b2-8df3-44ae-bb2e-89086c8b69a4_file display_value Text value of identified field Text "Amp" blob_value Blob link value in JSON format of identified field JSON value {id, name, url} Attached file can be found in Benchling float_value Floating point value of identified field Floating Point 2, 4.56, 4334.6493, etc date_value Date format value of identified field datetime 1/8/20 datetime_value Date format with timestamp value of identified field Timestamp with timezone 2019-12-05T19:15:00 integer_value Integer value of identified field Integer 1, 2, 54, etc json_value JSON value of identified field JSON Value linked_batch_id Unique id of any batch the field object is linked to Foreign key for batch.id bat_Gs8PtV0K linked_box_id Unique id of any box the field object is linked to Foreign key for box.id box_oz4ZE0MN linked_container_id Unique id of any container the field object is linked to Foreign key for container.id con_gQMDFBm4 linked_entry_id Unique id of any entry the field object is linked to Foreign key for entry.id etr_GtcscEZq linked_location_id Unique id of any location the field object is linked to Foreign key for location.id loc_Y2v8daz0 linked_plate_id Unique id of any plate the field object is linked to Foreign key for plate.id plt_S5ALalNc linked_result_id Unique id of any result the field object is linked to Foreign key for result.id 6498dd5a-1b4b-4954-826f-bfcfd1496373 linked_run_id Unique id of any run the field object is linked to Foreign key for run.id 343494f6-e633-4523-9aa6-26898c99f482 linked_registry_entity_id Unique id of any registered entity the field object is linked oo Foreign key for registry_entity.id bfi_cooUBrYb value_index The position number of a given value for a field that supports multiple values Integer (or null) null, 1, 2, 6, etc "null" = Not Multiselect.1,2,3,4, etc = Position of multi-select field
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Character Varying sfs_jBu9uUnv, etc. Primary key for a table name Name of dropdown in Benchling Character Varying Color, Analytes, etc. archived$ Archival state for dropdown in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for dropdown in Benchling Character Varying null, Made in Error, Retired, Other, etc null = object not archived
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Character Varying sfso_2v93jfF9, etc. Primary key for a table dropdown_id Reference to parent dropdown ID Character Varying sfs_jBu9uUnv, etc. Refers to dropdown.id name Name of dropdown option in Benchling Character Varying Color, Analytes, etc. position Relative position of dropdown option in the dropdown Integer 0, 3, etc. Ranges from 0 to (# options in dropdown - 1) archived$ Archival state for dropdown option in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for dropdown option in Benchling Character Varying null, Made in Error, Retired, Other, etc null = object not archived
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 url url for each object in Benchling Browser URL https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP\-Entry%20Namet/etr\_gRogHFOb\-untitled/edit
Applied filter(s): IS_NOT_ARCHIVED
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry archived$ Archival state for object in Benchling Boolean TRUE, FALSE true = object archived archive_purpose$ Archival reason for object in Benchling Text null, Made in Error, Retired, Other, etc null = object not archived created_at Created date for object Timestamp without timezone 2019-12-06T23:24:44.885478 modified_at Most recent modified date for object Timestamp without timezone 2019-12-06T23:24:44.885478 name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc parent_folder_id Unique identifier for folder containing object Foreign key for folder.id lib_J3tmt8BP
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table handle Unique username chosen by individual users or username defined for a Benchling Apps Text "ssiegfried" Handle can be changed at any point to any other unique string of text/integers name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc email Unique email associated with each user account , column will be null for Benchling App accounts Email "[email protected] " is_suspended Suspension status for each user or app FALSE, TRUE FALSE, TRUE TRUE = Suspended user created_at Created date for user or app Timestamp without timezone 2019-12-06T23:24:44.885478
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table handle Unique username chosen by individual users Text "ssiegfried" Handle can be changed at any point to any other unique string of text/integers name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc email Unique email associated with each user account Email "[email protected] " is_suspended Suspension status for each user FALSE, TRUE FALSE, TRUE TRUE = Suspended user created_at Created date for user Timestamp without timezone 2019-12-06T23:24:44.885478
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table team_id Unique identifier for the assignee's team Foreign key for team.id team_oh5xGqrm user_id Unique identifier for user Foreign key for user.id ent_yXrL3BjX See User Table for more information role Team membership status for an individual user ADMIN, MEMBER ADMIN, MEMBER
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table name Name of object in Benchling Character Varying Transfection Entry, QC Results, Therapeutic Cell Line, etc description Description given to object Text "Fermentation Workflow"
Note: These tables exist only in their $raw
form; consider performing a JOIN on the relevant schema table.
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry name Unique identifier for the request Character Varying Transfection Entry, Therapeutic Cell Line bases A string representing the bases that make up the DNA Sequence Character Varying agtctgttgggatggccacttaccacatcgtaccccta[...] bases_length_exceeds_limit Whether or not the length of the bases
field exceeds the limit Boolean false
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc Primary key for a table source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV If an object isn't in a project, the permissions will be derived from the Registry name Unique identifier for the request Character Varying Transfection Entry, Therapeutic Cell Line bases A string representing the bases that make up the DNA Oligo Character Varying agtctgttgggatggccacttaccacatcgtaccccta[...]
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table prs_hVI52tJk source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV name Name of object in Benchling Character varying Analytical SEC 26 display_id Unique identifier surfaced in the actual Benchling site Prefix-unique number SEC26 creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without time zone 2020-06-04T00:11:56.132400 modified_at Most recent modified date for object Timestamp without time zone 2020-06-04T00:11:56.132400 url URL for each object in Benchling Browser URL https://demo\.benchling\.com/demo/f/lib\_LDMZLtYM\-media\-prep/prs\_hVI52tJk\-\-analytical\-sec\-26/edit folder_id Unique identifier for folder containing object Foreign key for folder.id lib_LDMZLtYM execution_type Selected type for how tasks are executed ENTRY, DIRECT ENTRY, DIRECT archived$ Archival state for object in Benchling boolean FALSE, TRUE archive_purpose$ Archival reason for object in Benchling Character varying null, Made in Error, Retired, Other, etc workflow_flowchart_node_config_id Unique identifier for workflow_flowchart_node_config Foreign key for workflow_flowchart_node_config.id wffcnc_giVNQcTL workflow_flowchart_config_version_id Unique identifier for workflow_flowchart_config_version Foreign key for workflow_flowchart_config_version.id wffccv_giVNQcAF
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table prstsch_0JAxhOhS schema_type Schema type selected for schema of object Text workflow_task Always workflow_task for this table name Name of object in Benchling Character varying Analytical SEC system_name Name of warehouse table for this schema Character varying analytical_sec execution_type Selected type for how tasks are executed ENTRY, DIRECT ENTRY, DIRECT prefix Prefix used when creating workflow tasks from this schema Character varying SEC workflow_task_group_prefix Prefix used when creating workflow task groups from this schema Character varying SEC creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without time zone 2020-06-04T00:11:56.132400 modified_at Most recent modified date for object Timestamp without time zone 2020-06-04T00:11:56.132400 url URL for each object in Benchling Browser URL https://demo\.benchling\.com/demo/f/lib\_LDMZLtYM\-media\-prep/prs\_hVI52tJk\-\-analytical\-sec\-26/edit can_set_assignee_on_task_creation Determines if assignees can be set when a task is created Boolean TRUE, FALSE folder_id Unique identifier for folder containing object Foreign key for folder.id lib_LDMZLtYM workflow_task_status_lifecycle_id Unique identifier for workflow_task_status_lifecycle Foreign key for workflow_task_status_lifecycle.id prstswf_J8s40D7l default_responsible_team_id Unique identifier for team Foreign key for team.id team_oh5xGqrm default_creation_folder_id Unique identifier for default folder where tasks of this schema are created Foreign key for folder .id lib_LDMZLtYM default_entry_execution_folder_id Unique identifier for default folder where tasks of this schema are executed Foreign key for folder.id lib_LDMZLtYM archived$ Archival state for object in Benchling boolean FALSE, TRUE archive_purpose$ Archival reason for object in Benchling Character varying null, Made in Error, Retired, Other, etc
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wftask_hVI52tJk source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV display_id Unique identifier surfaced in the actual Benchling site Prefix-unique number SEC26-T5 creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without time zone 2020-06-04T00:11:56.132400 modified_at Most recent modified date for object Timestamp without time zone 2020-06-04T00:11:56.132400 scheduled_on_date Date the task is scheduled to be performed Date 2020-06-04 assignee_id Unique identifier for assigned user Foreign key for user.id ent_yXrL3BjX workflow_task_group_id Unique identifier for workflow_task_group Foreign key for workflow_task_group.id prs_hVI52tJk workflow_task_schema_id Unique identifier for workflow_task_schema Foreign key for workflow_task_schema.id prstsch_0JAxhOhS workflow_task_status_id Unique identifier for workflow_task_status Foreign key for workflow_task_status.id wfts_A6CmVrOp execution_entry_id Unique identifier for entry Foreign key for entry.id etr_GtcscEZq execution_user_id Unique identifier for user Foreign key for user.id ent_yXrL3BjX executed_on Date the task was executed Timestamp without time zone 2020-06-04T00:11:56.132400 archived$ Archival state for object in Benchling Boolean FALSE, TRUE archive_purpose$ Archival reason for object in Benchling Character varying null, Made in Error, Retired, Other, etc workflow_flowchart_id Unique identifier for workflow_flowchart Foreign key for workflow_flowchart.id wffc_giVNQcAF workflow_flowchart_task_id Unique identifier for a flowchart workflow_task Foreign key for workflow_task.id wftask_OnnsW08k
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table prsosch_kz6y7T4o schema_type Schema type selected for schema of object Text workflow_output Always workflow_output for this table name Name of object in Benchling Character varying Analytical SEC system_name Name of warehouse table for this schema Character varying analytical_sec prefix Prefix used when creating workflow tasks from this schema Character varying SEC archived$ Archival state for object in Benchling boolean FALSE, TRUE archive_purpose$ Archival reason for object in Benchling Character varying null, Made in Error, Retired, Other, etc
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wftask_hVI52tJk source_id The project or registry that the object's permissions comes from Foreign key for project.id or registry.id src_hh9ffHqV display_id Unique identifier surfaced in the actual Benchling site Prefix-unique number SEC26-T5 creator_id Unique identifier for creator of object Foreign key for user.id ent_yXrL3BjX created_at Created date for object Timestamp without time zone 2020-06-04T00:11:56.132400 modified_at Most recent modified date for object Timestamp without time zone 2020-06-04T00:11:56.132400 workflow_task_group_id Unique identifier for workflow_task_group Foreign key for workflow_task_group.id prs_hVI52tJk workflow_task_id Unique identifier for workflow_task that output is for Foreign key for workflow_task.id wftask_hVI52tJk workflow_task_status_id Unique identifier for workflow_task_status Foreign key for workflow_task_status.id wfts_A6CmVrOp workflow_output_schema_id Unique identifier for workflow_output_schema Foreign key for workflow_output_schema.id prsosch_kz6y7T4o archived$ Archival state for object in Benchling boolean FALSE, TRUE archive_purpose$ Archival reason for object in Benchling Character varying null, Made in Error, Retired, Other, etc
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wfts_A6CmVrOp display_name Name of object in Benchling Character varying Completed status_type Type of status PENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID PENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table prstswf_J8s40D7l name Name of object in Benchling Character varying Entry Review schema_execution_type Type of execution for task schemas using this lifecycle DIRECT, ENTRY DIRECT, ENTRY initial_workflow_task_status_id Unique identifier for workflow_task_status Foreign key for workflow_task_status.id wfts_A6CmVrOp The first status of the lifecycle. lifecycle edges determine the rest of the status order.
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table prstswfe_aziohrUt workflow_task_status_lifecycle_id Unique identifier for workflow_task_status_lifecycle Foreign key for workflow_task_status_lifecycle.id prstswf_J8s40D7l Lifecycle that the edge is for from_workflow_task_status_id Unique identifier for workflow_task_status Foreign key for workflow_task_status.id wfts_A6CmVrOp The starting status of the edge to_workflow_task_status_id Unique identifier for workflow_task_status Foreign key for workflow_task_status.id wfts_Td7q3eiM The ending status of the edge
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wffc_giVNQcAF
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wffcnc_giVNQWcXS workflow_task_schema_id Unique identifier for workflow_task_schema Foreign key for workflow_task_schema.id prstsch_OnnsV06w
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wffcec_poVNQcQE workflow_flowchart_id Unique identifier for workflow_flowchart Foreign key for workflow_flowchart.id wffc_giVNQcAF from_flowchart_node_config_id Unique identifier for workflow_flowchart_node_config Foreign key for workflow_flowchart_node_config.id wffcnc_mcMKcXS to_node_config_id Unique identifier for workflow_flowchart_node_config Foreign key for workflow_flowchart_node_config.id wffcnc_nwICpoe
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wfle_kmQWplX to_workflow_task_id Unique identifier for workflow_task Foreign key for workflow_task.id wftask_OnnsW08k from_workflow_task_id Unique identifier for workflow_task Foreign key for workflow_task.id wftask_OnnsW08k to_workflow_output_id Unique identifier for workflow_output Foreign key for workflow_output wfout_5cJLQKVF from_workflow_output_id Unique identifier for workflow_output Foreign key for workflow_output.id wfout_5cJLQKVF
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wffccv_giVNQcAF workflow_flowchart_config_id Unique identifier for workflow_flowchart_config Foreign key for workflow_flowchart_config.id wffcc_wcIJAPL workflow_flowchart_id Unique identifier for workflow_flowchart Foreign key for workflow_flowchart.id wffc_giVNQcAF
Table Row Definition Value Type Example values (if applicable) Notes id Unique Benchling-prescribed ID for each line item in table Format dependent on table wffcc_wcIJAPL workflow_task_schema_id Unique identifier for workflow_task_schema Foreign key for workflow_task_schema.id prstsch_OnnsV06w