❗️This page has now been retired
Please update any bookmarks to point to the new Warehouse Tables page.
Note that this page doesn't display tables as well as we'd hope. Please zoom in your browser with CTRL-+ or CMD-+.
Each Benchling Warehouse (WH) table has many columns that represent the data contained in each table. Use the following information help understand how each table can be used to directly query the data you have stored in Benchling.
To see all Benchling Tables in diagram format please navigate to https://docs.benchling.com/docs/warehouse-tables-v2
The following information is outlined below for every WH table:
- Column Name
- Column Definition
- Value Type
- Example Values
- Useful Notes
📘As discussed in Warehouse Tables, these tables are Postgres views that represent a "cleaned up" version of the raw data. For applicable tables, we've specified the filter(s) being applied to the raw data in order to produce the cleaned table. These filters are described here:
| Filter key | Filter description |
|---|
IS_NOT_ARCHIVED | Filters away rows where the archived$ column is True |
LINKED_FIELD_IS_NOT_ARCHIVED | Filters away rows in the field table where the corresponding row in the field_definition table's archived$ column is True. This look up is an outer join on field.field_definition_id = field_definition.id |
STATIC_IS_REVIEWED | Performs a join between the entry$raw table and the result table (result.entry_id = entry.id). Filters away rows whose corresponding entry IS NOT accepted (entry$raw.review_status != ACCEPTED) |
STATIC_IS_VALID | Filters away result rows where validation_status IS NOT NULL AND the value is not VALID or PARTIALLY_VALID. |
See below for all tables relating to the Benchling Notebook
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Primary key for a Warehouse table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Format dependent on table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| display_id | Unique identifier surfaced in the actual Benchling site | prefix-unique entry number | EXP001 or EXP20000416 | I.E Unique Entry number |
| folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_J3tmt8BP | If object not in folder, then folder_id = project_id.If null, then object not in folder/project |
| workflow_id | Unique identifier for workflow containing object | Foreign key for workflow.id | wfw_DMcZhu4A | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| review_process_version_id | Unique identifier for version id of review process | Foreign key for review_process_version.id | rlc_SN0IwfBx | |
| review_status | Current review status for object | null, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED | null, NEEDS_REVIEW, NEEDS_REVISION, REJECTED, ACCEPTED | |
| review_requested_at | Date of most recent review requested for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | Date of most recent review request |
| review_status_changed_at | Date of review status change for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| url | url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib\_J3tmt8BP-Entry%20Namet/etr\_gRogHFOb-untitled/edit |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | See User Table for more information |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | See Entry Table for more information |
| review_process_stage_id | Unique identifier for review process stage | null
, Foreign key for review_process_stage.id | rlcstg_ZjNgNXks | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | See User Table for more information |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | If entry has multiple authors there will be multiple rows per entry_id. See Entry Table for more information |
| Table Row | Definition | Value Type | Example values ( if applicable ) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr GtcscEZq, locY2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| created_object_id | Unique identifier for the created object | Foreign key for any type of object that can have a creation context | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| entry_id | Unique identifier for the notebook entry that the object was created in | Foreign key for entry.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| worksheet_id | Unique identifier for the worksheet that the object was created in | Foreign key for worksheet.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| procedure_step_execution_id | Unique identifier for the the associated procedure step execution instance for the worksheet step that the object was created in | Foreign key for procedure_step_execution_isntance.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| parameter_measured_value_id | Unique identifier for the created procedure parameter measured value | Foreign key for parameter_measured_value.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| parameter_confirmation_value_id | Unique identifier for the created procedure parameter confirmation value | Foreign key for parameter_confirmation_value.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| parameter_planned_value_id | Unique identifier for the created procedure parameter planned value | Foreign key for parameter_planned_value.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| run_id | Unique identifier for the created lab auto run | Character varying | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| result_id | Unique identifier for the created result | Foreign key for result.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| entity_id | Unique identifier for the created entity | Foreign key for entity.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| box_id | Unique identifier for the created box | Foreign key for box.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| plate_id | Unique identifier for the created plate | Foreign key for plate.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| container_id | Unique identifier for the created container | Foreign key for container.id | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| current_version | Version id of the current (i.e. most up-to-date) review process version | Foreign key for review_process_version.id | rlc_6x2onGXv | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| project_id | Unique identifier for project | Foreign key for project.id | src_D44xhOol | |
| review_process_id | Unique identifier for review process | Foreign key for review_process.id | rlc_fSmNiu8i | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| review_process_id | Unique identifier for review process | Foreign key for review_process.id | rlc_fSmNiu8i | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| name | Name of the review processes version | Character Varying | Self Review RLC, Lab Sequential | |
| lifecycle_type | Review process type | Enumeration | SELF_REVIEW
, SEQUENTIAL
, PARALLEL
| |
| completion_stage | Status of a completed review using review process | Character Varying | ACCEPTED | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| name | Name of the review process stage | Character Varying | Self review, Stage 1 | |
| action | Text appearing in the user-facing label when completing stage | Character Varying | ACCEPT | |
| review_process_version_id | Unique identifier for version id of review process | Foreign key for review_process_version.id | rlc_SN0IwfBx | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | identifier of the run | Character varying | ee6da040-fa64-4e47-9a5e-98892fa32580 | |
| v3_id | identifier of the run | Character varying | | API identifier used in future versions of the Benchling API. May be null
while in development. |
| source_id | project that the run is in | Character varying | src_RWL0Oekn | |
| schema | lab auto schema this run is part of | Character varying | transfection_v1_schema | |
| created_at$ | when the run was created | timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| creator_id$ | who created it | Character varying | ent_naLWig4C | |
| entry_id$ | which entry it was created in | Character varying | etr_nLrUvmPx | |
| archived$ | whether the run was archived | boolean | false | |
| archive_purpose$ | reason for why the run was archived, if archived | Character varying | null | |
| validation_status$ | validation status | Character varying | VALID | |
| validation_comment$ | validation information | Character varying | null | |
| plate | custom created columns as part of the run configuration | Character varying | "plt_2Q09VfYn" | |
Definitions
| Term | Definition |
|---|
| Procedure | A template for the recipe or assay. Lives in a template collection. |
| Procedure run | An actual execution of a procedure. This object lives in a project and has method execution instances that are associated with Workflow tasks that the user will work through. Also referred to as an experiment run in the UI. |
| Procedure run condition | Condition |
| Procedure run condition replicate | A single replicate of a condition. The UI doesn't have a singular term for this. |
| Method | Unit operation |
| Parameter | Material input, material output, equipment, or parameter. The parameter_type column disambiguates between the four. Data parameters are just referred to as "parameters" in the UI. |
| Parameter planned value | The expected value for a parameter for a particular procedure run |
| Parameter confirmation value | The confirmed value for a parameter for a particular procedure run, filled in by the operator |
| Parameter measured value | The measured value of a parameter during the course of executing a procedure |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| study_id | Unique identifier for the parent study of the procedure run | Foreign key for study.id | stdy_iG0LW1XU | |
| procedure_id | Unique identifier for the template procedure that the procedure run was created from | Character Varying | pc_aX3ST2SH | |
| workflow_task_id | Unique identifier for associated Workflow task | Foreign key for workflow_task.id | wftask_gLZqJzcl | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| source_procedure_method_execution_instance_id | Unique identifier for source procedure method execution instance | Character Varying | pcmei_gLZqJzcl | |
| target_procedure_method_execution_instance_id | Unique identifier for target procedure method execution instance | Character Varying | pcmei_zsGLtpSo | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| procedure_run_id | Unique identifier for parent procedure run | Character Varying | pcr_gLZqJzcl | |
| workflow_task_id | Unique identifier for associated Workflow task | Foreign key for workflow_task.id | wftask_gLZqJzcl | |
| worksheet_id | Unique identifier for associated worksheet | Foreign key for worksheet.id | wks_gLZqJzcl | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| Table row | Definition | Value type | Examples values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| method_execution_instance_id | Unique identifier for the associated method execution instance | Foreign key for procedure_method_execution_instance.id | pmei_hh9ffHqV | |
| transitioned_at | Time entered when the associated Workflow task was transitioned to the status specified in status_display_name | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| status_display_name | Status of Workflow task associated with the method | Character varying | In progress, Failed, Skipped | |
| comment | Comment, if any, associated with transitioning (starting, completing, skipping, or failing) the method | Character Varying | Delayed | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_ hh9ffHqV | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| position | Zero-indexed position of the step within a step group | Integer | 0, 1 | |
| step_group_type | Type of the parent step group | Character Varying | PRE_RUN, RUN | |
| workflow_task_id | Unique identifier for associated Workflow task | Foreign key for workflow_task.id | wftask_gLZqJzcl | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of parent parameter in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| method_execution_instance_id | Unique identifier for the execution instance of a method for a replicate of a condition | Foreign key for procedure_method_execution_instance.id | pcmei_Bz5Dlmu5 | Methods are referred to as “unit operations” in the Benchling UI |
| parameter_type | Parameter type of the parent parameter | Character Varying | EQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETER | Data parameters are referred to as “parameters” in the Benchling UI |
| parameter_id | Unique identifier for the parent parameter | Character Varying | pcparam_cCO8Dvfc | Can be used for queries across multiple executions of the same procedure |
| value | The planned value for the parameter | JSON value | 350, null, bfi_GuPYFZQH, water | |
| type | Data type of the parent parameter version | Character Varying | entity_link, text, float | |
| unit_id | Unique identifier for the unit associated with the parent parameter version | Foreign key for unit.id | null, unit_aWP1Asqp | |
| amount | The planned amount for a material input. Will always be null for other parameter types. | Floating point | null, 4.2 | |
| amount_unit_id | Unique identifier for the amount unit for a material input. Will always be null for other parameter types. | Foreign key for unit.id | null, unit_aWP1Asqp | |
| container_id | 1Unique identifier for the associated container | Foreign key for container.id | null, con_wQM2Lshs | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of parent parameter in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| method_execution_instance_id | Unique identifier for the execution instance of a method for a replicate of a condition | Foreign key for procedure_method_execution_instance.id | pcmei_Bz5Dlmu5 | Methods are referred to as “unit operations” in the Benchling UI |
| parameter_type | Parameter type of the parent parameter | Character Varying | EQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETER | Data parameters are referred to as “parameters” in the Benchling UI |
| parameter_id | Unique identifier for the parent parameter | Character Varying | pcparam_cCO8Dvfc | Can be used for queries across multiple executions of the same procedure |
| value | The confirmed value for the parameter | JSON value | 350, null, bfi_GuPYFZQH, water | |
| type | Data type of the parent parameter version | Character Varying | entity_link, text, float | |
| unit_id | Unique identifier for the unit associated with the parent parameter version | Foreign key for unit.id | null, unit_aWP1Asqp | |
| amount | The planned amount for a material input. Will always be null for other parameter types. | Floating point | null, 4.2 | |
| amount_unit_id | Unique identifier for the amount unit for a material input. Will always be null for other parameter types. | Foreign key for unit.id | null, unit_aWP1Asqp | |
| container_id | 1Unique identifier for the associated container | Foreign key for container.id | null, con_wQM2Lshs | |
| recorded_at | The date/time that the parameter was confirmed, or for material inputs, was added | Timestamp without time zone | null, 2024-09-06T14:38:29 | |
| comment | Comment, if any, associated with the parameter confirmation | Character Varying | Using more salt | Blank comments are stored as an empty string |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of parent parameter in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| method_execution_instance_id | Unique identifier for the execution instance of a method for a replicate of a condition | Foreign key for procedure_method_execution_instance.id | pcmei_Bz5Dlmu5 | Methods are referred to as “unit operations” in the Benchling UI |
| parameter_type | Parameter type of the parent parameter | Character Varying | EQUIPMENT, MATERIAL_INPUT, MATERIAL_OUTPUT, DATA_PARAMETER | Data parameters are referred to as “parameters” in the Benchling UI |
| parameter_id | Unique identifier for the parent parameter | Character Varying | pcparam_cCO8Dvfc | Can be used for queries across multiple executions of the same procedure |
| value | The measured value for the parameter | JSON value | 350, null, bfi_GuPYFZQH, water | |
| type | Data type of the parent parameter version | Character Varying | entity_link, text, float | |
| unit_id | Unique identifier for the unit associated with the parent parameter version | Foreign key for unit.id | null, unit_aWP1Asqp | |
| amount | The planned amount for a material input. Will always be null for other parameter types. | Floating point | null, 4.2 | |
| amount_unit_id | Unique identifier for the amount unit for a material input. Will always be null for other parameter types. | Foreign key for unit.id | null, unit_aWP1Asqp | |
| container_id | 1Unique identifier for the associated container | Foreign key for container.id | null, con_wQM2Lshs | |
| recorded_at | The date/time that the parameter was confirmed, or for material inputs, was added | Timestamp without time zone | null, 2024-09-06T14:38:29 | |
| comment | Comment, if any, associated with the parameter confirmation | Character Varying | Using more salt | Blank comments are stored as an empty string |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| plate_id | Unique identifier for the plate | Foreign key for plate.id | plt_wQM2Lshs | |
| parameter_confirmation_value_id | Unique identifier a confirmed parameter value | Foreign key for parameter_confirmation_value.id | ppvc_aWP1Asqp | |
| parameter_planned_value_id | Unique identifier a planned parameter value | Foreign key for parameter_planned_value.id | ppvp_aWP1Asqp | |
| well_position | Position of the plate well where the parameter value was confirmed | Character Varying | A3 | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| description | Description of the condition | Character Varying | Control | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| procedure_run_id | Unique identifier for the parent procedure run | Foreign key for procedure_run.id | prc_wa2kjuQaQ | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| condition_id | Unique identifier for the parent condition | Foreign key for procedure_run_condition.id | pcrc_wa2kjuQaQ | |
| replicate_number | Unique identifier for the replicate within the condition group | Integer | 1 | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent yXrL3BjX, etr GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| procedure_run_condition_replicate_id | Unique identifier for a specific replicate of a condition | Foreign key for procedure_run_condition_replicate_id | prcr_qHF3HNaT | |
| method_execution_instance_id | Unique identifier for the execution instance of a method (unit operation) for a replicate of a condition | Foreign key for procedure_method_execution_instance.id | pcmei_Bz5Dlmu5 | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| parent_schema_id | Unique identifier for schema which object is derived from | Foreign key for schema.id | ts_XDQ0OW6s | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| parent_schema_id | Unique identifier for schema which object is derived from | Foreign key for schema.id | ts_XDQ0OW6s | |
Applied filter(s): IS_NOT_ARCHIVED, STATIC_IS_REVIEWED, STATIC_IS_VALID
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| v3_id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | | API identifier used in future versions of the Benchling API. May benullwhile in development. |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema | Unique Schema name for object | Text | "Fermentation Results" | |
| created_at$ | Date created for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at$ | Date object was modified in Benchling | Timestamp without timezone | 2019-12-08T22:34:55.174635 | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| custom$ | Any custom created columns will be shown here | JSONB | | Custom Columns are created after a result table has been entered into a Notebook entry |
| entity | The Entity an object is mapped to | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| entry_id$ | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | See Entry Table for more information |
| run_id$ | Unique identifier for Entry | Foreign key for run.id | a11d82b2-8df3-44ae-bb2e-89086c8b69a4 | See Entry Table for more information |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| validation_status$ | Validation status for individual result object | VALID, INVALID | VALID, INVALID | |
| validation_comment$ | Validation comment for individual result object | Text | "Standard curve failure" | |
| field_validation$ | Validation comment for each field of the Result object | JSONB | {"timestamp":{"validation_comment": null, "validation_status": "VALID"}, "fluorescence_rfu":{"validation_comment": null, "validation_status": "VALID"}, "entity":{"validation_comment": null, "validation_status": "VALID"}} | |
| Speed(EXAMPLE) | Individual field of Result object | Floating Point | 48.7 | Value dependent on field type.See field table for more information |
| Color(EXAMPLE) | Individual field of Result object | Text | "Green" | Value dependent on field type.See field table for more information |
| Resistance(EXAMPLE) | Individual field of Result object | Text | ["Ampicillin", "Streptomycin"] | Value dependent on field type.See field table for more information |
| result_field(EXAMPLE) | Individual field of Result object | Value dependent on field type | integer, floating point, text, blob link, etc | Value dependent on field type.See field table for more information |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| entity_type | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry | Oligo schema are listed as dna_sequence types.See Schema table for more information |
| registry_id | Unique identifier for an Organization's Registry | Foreign Key for reigstry.id | src_rdw6rOsL | 1 Registry per Organization |
| prefix | Prefix selected for each schema object | Text | "p" | Prefix will always come before Registry ID for registered objects |
| description | Schema description defined by the user | Text | "Cell lines from project Aurelia. Please talk to the lab manager before using." | There is a 1000 character limit on schema descriptions. |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| file_registry_id | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_J3tmt8BP | If object not in folder, then folder_id = project_id.If null, then object not in folder/project |
| project_id | Unique identifier for project containing object | Foreign key for project.id | src_PDSy77zE | If null, then object isn't contained within a project |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| type | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry | Oligo schema are listed as dna_sequence types |
| validation status | Registration validation status of object | PASSED, FAILED | PASSED, FAILED | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| is_registered | denotes whether this object is registered | boolean | True | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | registration_origin_bfi_EVf5Yd8r | Primary key for a table |
| source_id | The registry | Foreign key to registry.id | src_hh9ffHqV | |
| entity_id | The entity | Foreign key to entity.id | bfi_EVf5Yd8r | |
| registered_at | Timestamp when entity was registered | Timestamp without timezone | 2023-07-26T21:46:53.670489 | |
| origin_entry_id | Unique identifier for Entry | Foreign key to entry.id | etr_EuoDTxy1 | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| file_registry_id | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_J3tmt8BP | If object not in folder, then folder_id = project_id.If null, then object not in folder/project |
| project_id | Unique identifier for project containing object | Foreign key for project.id | src_PDSy77zE | If null, then object isn't contained within a project |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| type | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry, rna_oligo | Oligo schema are listed as dna_sequence types |
| validation status | Registration validation status of object | PASSED, FAILED | PASSED, FAILED | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| entity_id | The entity for which this is an alias | Foreign key for entity.id | ent_yXrL3BjX | |
| alias | Identifier serving as the entity alias | Text | My Memorable Alias | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| created_at$ | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at$ | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| mixture_id | Unique ID for mixture object | Foreign key for mixture.id | bfi_gQMDFBm4 | |
| component_entity_id | Unique identifier for entity object | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| amount | Amount of content | Floating Point | 6, 6.87, 7799499.2359, etc | |
| amount_text | Amount as text | Character Varying | 100 grams | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| file_registry_id | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_J3tmt8BP | If object not in folder, then folder_id = project_id.If null, then object not in folder/project |
| project_id | Unique identifier for project containing object | Foreign key for project.id | src_PDSy77zE | If null, then object isn't contained within a project |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| type | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry, rna_oligo | Oligo schema are listed as dna_sequence types |
| validation status | Registration validation status of object | PASSED, FAILED | PASSED, FAILED | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| is_registered | denotes whether this object is registered | boolean | True | |
| amount | how much of the mixture | double | 100 | |
| units | units | Character Varying | grams | |
| allows_measured_ingredients | whether you can have measured ingredients in this mixture | boolean | true | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema | Unique Schema name for object | Text | "Fermentation Results" | |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| creator_id$ | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at$ | Created date for object (when the entity was originally created) | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at$ | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| name$ | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| file_registry_id$ | Unique Benchling Registry ID associated with each registered entity | Text | "p001" | |
| schema_id$ | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| folder_id$ | Unique identifier for folder containing object | Foreign key for folder.id | lib_J3tmt8BP | If object not in folder, then folder_id = project_id.If null, then object not in folder/project |
| project_id$ | Unique identifier for project containing object | Foreign key for project.id | src_PDSy77zE | If null, then object isn't contained within a project |
| url$ | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| type$ | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry, rna_oligo | Oligo schema are listed as dna_sequence types |
| is_registered$ | Is entity currently registered | Boolean | True, False | True = Entity has been registered |
| Color(EXAMPLE) | Individual Schema Field | Text | "green" | Value dependent on field type.See field table for more information |
| Plasmid(EXAMPLE) | Individual Schema Field | foreign key for plasmid entity | seq_HXnZhUkT | Value dependent on field type.See field table for more information |
| Length(EXAMPLE) | Individual Schema Field | Floating Point | 4.567 | Value dependent on field type.See field table for more information |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| registry_id | Unique identifier for an Organization's Registry | Foreign Key for reigstry.id | src_rdw6rOsL | 1 Registry per Organization |
| entity_schema_id | Unique identifier for schema object | Foreign key for schema.id | ts_XDQ0OW6s | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose | Archival reason for object in Benchling | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Available archive purpose options dependent on object |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| entity_id | Unique identifier for entity object | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| concentration_si | Concentration value for content - note that this is in SI units, not the original units created in the application. | Floating Point | 6, 6.87, 7799499.2359, etc | |
| concentration_display_units | Original concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column. | Concentration Units | ug/mL | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| type | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry | Oligo schema are listed as dna_sequence types |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose | Archival reason for object in Benchling | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Available archive purpose options dependent on object |
| registry_id | Unique identifier for an Organization's Registry | Foreign Key for reigstry.id | src_rdw6rOsL | 1 Registry per Organization |
| prefix | Prefix selected for each schema object | Text | "p" | Prefix will always come before Registry ID for registered objects |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose | Archival reason for object in Benchling | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Made in error, Retired, Expended, Shipped, Contaminated, Expired, Missing, Merged, Other | Available archive purpose options dependent on object |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| location_id | Unique ID for location that contains object | Foreign key for location.id | loc_Y2v8daz0 | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| location_id | Unique ID for location that contains object | Foreign key for location.id | loc_Y2v8daz0 | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| location_id | Unique ID for location that contains object | Foreign key for location.id | loc_Y2v8daz0 | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| barcode | Displays benchling barcode of the object | Text | 15MLFALCON006 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| box_id | Unique ID for box object | Foreign key for box.id | box_oz4ZE0MN | |
| location_id | Unique ID for location that contains object | Foreign key for location.id | loc_Y2v8daz0 | |
| plate_id | Unique ID for plate object | Foreign key for plate.id | plt_K9VZG06I | |
| row_index | Row position where container is located | integer | 5, 7, 12, etc | Container specific-must be in box |
| column_index | Column position where container is located | integer | 5, 7, 12, etc | Container specific-must be in box |
| volume_si | Volume value for container content - note that this is in SI units, not the original units created in the application. | Floating Point | 5, 7, 12, etc | |
| volume_display_units | Original volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column. | Text for volume units | mL, uL, nL, etc | |
| checkout_status | Indicates whether the container is checked-out, reserved, or available. | character varying | AVAILABLE, RESERVED, CHECKED_OUT | |
| checkout_status_modified_at | The date the container was last checked out, reserved, or checked in | timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| checkout_assignee_team_id | Unique ID for the team the container is checked out or reserved for | character varying | team_oh5xGqrm, null | null = checkout assignee is a user |
| checkout_assignee_user_id | Unique ID for the user the container is checked out or reserved for | character varying | ent_naLWig4, null | null = checkout assignee is a team |
| restriction_status | NOT_APPLICABLE for fixed plate wells and RESTRICTED or UNRESTRICTED for other containers | character varying | RESTRICTED, UNRESTRICTED, NOT_APPLICABLE | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| batch_id | Unique identifier for batch object | Foreign key for batch.id | bat_Gs8PtV0K | What batch is in the container |
| container_id | Unique ID for container object | Foreign key for container.id | con_gQMDFBm4 | |
| entity_id | Unique identifier for entity object | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| concentration_si | Concentration value for content - note that this is in SI units, not the original units created in the application. | Floating Point | 6, 6.87, 7799499.2359, etc | |
| concentration_display_units | Original concentration units for concentration_si value. For example, 5 g / L will have 0.005 in the concentration_si column and "g / L" in the concentration_display_units column. | Concentration Units | ug/mL | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| input_batch_id | Unique ID for batch to be transferred | Foreign key for batch.id | bat_Gs8PtV0K | Transfer Table-related; not workflow related |
| input_container_id | Unique ID for container that has entity/batch to be transferred to | Foreign key for container.id | con_gQMDFBm4 | Transfer Table-related; not workflow related |
| input_entity_id | Unique ID for entity to be transferred | Foreign key for registry_entity.id | bfi_cooUBrYb | Transfer Table-related; not workflow related |
| output_container_id | Unique ID for newly created container | Foreign key for container.id | con_gQMDFBm4 | Transfer Table-related; not workflow related |
| volume_si | Volume value for container content - note that this is in SI units, not the original units created in the application. | Floating Point | 5, 7, 12, etc | |
| volume_display_units | Original volume units for volume_si value. For example, 5 mL will have 0.005 in the volume_si column and "mL" in the volume_display_units column. | Text for volume units | mL, uL, nL, etc | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | character varying | con_gQMDFBm4_ent_naLWig4C, con_gQMDFBm4_team_oh5xGqrm | |
| container_id | Foreign key for container.id | character varying | con_gQMDFBm4 | |
| team_id | Unique ID for a team that is a sample owner for the container | character varying | team_oh5xGqrm, null | null = sample owner is a user |
| user_id | Unique ID for a user who is a sample owner for the container | character varying | ent_naLWig4C, null | null = sample owner is a team |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | character varying | con_gQMDFBm4_ent_naLWig4C, con_gQMDFBm4_team_oh5xGqrm | |
| container_id | Foreign key for container.id | character varying | con_gQMDFBm4 | |
| team_id | Unique ID for a team that is a sample owner for the container | character varying | team_oh5xGqrm, null | null = sample owner is a user |
| user_id | Unique ID for a user who is a sample owner for the container | character varying | ent_naLWig4C, null | null = sample owner is a team |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| parent_schema_id | Unique identifier for schema which object is derived from | Foreign key for schema.id | ts_XDQ0OW6s | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| request_id | Unique identifier for the request | Foreign key for request.id | req_qPtu1MSo | |
| user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | See User Table for more information |
| team_id | Unique identifier for the assignee's team | Foreign key for team.id | team_oh5xGqrm | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| request_id | Unique identifier for the request | Foreign key for request.id | req_qPtu1MSo | |
| sample_group_id | ID of the schemas designated for the request | Foreign key for schema.id | ts_gUQdTwR7 | ID's can be for containers, entities, or batches |
| request_task_id | Unique identifier for a task within a request | Foreign key for task.id | reqtsk_2nzie5Io | |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | See Entry Table for more information |
| workflow_id | Unique identifier for workflow containing object | Foreign key for workflow.id | wfw_DMcZhu4A | |
| status | Status for a request(requestor) | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| request_id | Unique identifier for the request | Foreign key for request.id | req_qPtu1MSo | |
| sample_group_id | ID of the schemas designated for the request | Foreign key for schema.id | ts_gUQdTwR7 | ID's can be for containers, entities, or batches |
| batch_id | Unique identifier for batch object | Foreign key for batch.id | bat_Gs8PtV0K | What batch is in the container |
| entity_id | Unique identifier for entity object | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| container_id | Unique ID for container object | Foreign key for container.id | con_gQMDFBm4 | |
| field_name | Display name for field on schema | Text | "Date Sequenced" | |
| row_index | Row position where container is located | integer | 5, 7, 12, etc | Container specific-must be in box |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| request_id | Unique identifier for the request | Foreign key for request.id | req_qPtu1MSo | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema | Unique Schema name for object | Text | "Fermentation Results" | |
| created_at$ | Date created for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| status$ | Status for a request fulfillment | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
| display_id$ | Display name for object in Benchling | prefix-unique number | request1, request2 | |
| url$ | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| scheduled_on$ | Date which the request is to be scheduled for | datetime | 1/8/20 | |
Applied filter(s):IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Character Varying | stdy_btFSmR0z | Primary key for a table |
| source_id | The id of the project that the object's permissions comes from | Foreign key for project.id | src_hh9ffHqV | |
| name | Name of the Study | Character Varying | Parameter screen for BT-111, Testing stability of BT-142 using accelerated degradation, etc | |
| design_entry_id | The id of the design entry for the study | Foreign key for entry.id | etr_Y3cmkCdx, null | Only applicable to Custom Studies - will be null for other study types. |
| phase | The study's phase | Character Varying | DESIGN, EXECUTION, COMPLETE | |
| display_id | Display name for object in Benchling | Prefix-unique number | CLIN1, ADT12, etc | |
| description | Description of the study | Text | Three month stability study for example drug candidate | |
| schema_id | Unique identifier for schema which object is derived from | Foreign key for study_schema.id | stdysch_CfbbyrNX | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without timezone | 2024-08-20T14:53:15.458544 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2024-08-23T13:34:03.96262 | |
| archived$ | Archival state for object in Benchling | Boolean | True, False | True indicates the object is archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null indicates the object is not archived |
This table is a “join” or “association” table that tracks the associations between various items (such as entities or containers) and Studies. In the Benchling application itself you won’t see these association objects listed anywhere. Instead, you see them on either end of the association. On an item like an entity you see the studies that it is associated with. On a study you see a list of items that have been associated with it.
For each row in this table, item_id and study_id will always be populated, and then depending on the item’s type, one of the various item-type-specific columns like entity_id will be populated, with the rest null. So if the item being associated is an entity, with the ID bfi_UVTa6PyJ, you will see bfi_UVTa6PyJ listed in both the item_id and entity_id columns for that row, and the other item-type-specific columns such as entry_id will be null for that row.
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | stdyitasn_d7LnbtQsFK7nEBXe | Primary key for this table. This is the ID of the association record itself, not the ID of the associated item or study. |
| source_id | The id of the project that the study item’s permissions comes from | Foreign key for project.id | src_ZJ0kzmAm | |
| item_id | The id of the item associated with the study | Foreign key for table dependent on item type | etr_gLFsdk9K, wftask_68fZLY8W, etc | |
| study_id | The id of the study that the item is associated with | Foreign key for bnch$study.id | stdy_fBzbWXmN | |
| analysis_id | The id of the study item, if the item is an analysis | Character Varying | ana_EoHIlnUD, null | Developer ID of the analysis. null if the item is not an analysis |
| box_id | The id of the study item, if the item is a box | Foreign key for box.id | box_ePewYTZf, null | null if the item is not a box |
| container_id | The id of the study item, if the item is a container | Foreign key for container.id | con_ZjUDdMtk, null | null if the item is not a container |
| dataset_id | The id of the study item, if the item is a dataset | Character Varying | dataset_mTIt1shB, null | Developer ID of the dataset. null if the item is not a dataset |
| entity_id | The id of the study item, if the item is an entity | Foreign key for entity.id | bfi_UVTa6PyJ, prtn_cIKy9MlJ, null | null if the item is not an entity |
| entry_id | The id of the study item, if the item is an entry | Foreign key for entry.id | etr_gLFsdk9K, null | null if the item is not an entry |
| plate_id | The id of the study item, if the item is a plate | Foreign key for plate.id | plt_5JHwKzwE, null | null if the item is not a plate |
| request_v2_submission_id | The id of the study item, if the item is a request | Foreign key for bnch$request_v2_submission$beta.id | rqsm_uESZvYDN, null | null if the item is not a request |
| test_order_id | The id of the study item, if the item is a test order | Foreign key for bnch$test_order$beta.id | tord_ftNuIhp3, null | null if the item is not a test order |
| workflow_task_id | The id of the study item, if the item is a workflow task | Foreign key for workflow_task.id | wftask_m6jQuRAx, null | null if the item is not a workflow task |
| worksheet_id | The id of the study item, if the item is a worksheet | Foreign key for bnch$worksheet$alpha.id | wks_EVsCXlta, null | null if the item is not a worksheet |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| modified_at | Most recent modified date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | stdysch_CfbbyrNX | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | study | |
| name | Name of object in Benchling | Character varying | Stability Study | |
| system_name | Name of warehouse table for this schema | Character varying | stability_study | |
| prefix | Prefix used for display IDs when creating studies from this schema | Character varying | ADT, PDT, CLIN, etc | |
| archived$ | Archival state for object in Benchling | Boolean | True, False | True indicates the object is archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null indicates the object is not archived |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| alias | Unique identifier for the workflow, based on prefix and sequential number | prefix-unique number | WF020 | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| description | Description given to object | Text | "Fermentation Workflow" | |
| status | Status for a request(requestor) | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
| last_stage_completed | Name of last stage entry marked as complete | Text | "Transformation" | |
| last_stage_completed_at | Timestamp of when status of last stage entry was marked as complete | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| workflow_template_version_id | API ID of workflow template used to generate this workflow | Foreign key for workflow_template_version.id | wfwtmplv_0MjnYgSk | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| version | Version#for workflow template | Integer | 1,3 65, etc | Auto-incremental when new workflow version is completed |
| workflow_template_id | Unique ID for workflow TEMPLATE | Foreign key for workflow_template.id | wfwtmpl_w6d11hNb | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| stage_name | Stage name in Benchling | Text | "Transfection" | |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | See Entry Table for more information |
| workflow_id | Unique identifier for workflow containing object | Foreign key for workflow.id | wfw_DMcZhu4A | |
| status | Status for a request(requestor) | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | IN_PROGRESS, REQUESTED, COMPLETED, SCHEDULED, CANCELLED | |
| exp_condition_values | Values available for Stage Experimental Conditions | Text | "Condition": "2" | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| schema_type | Schema type selected for schema of object | Text | entity, assay_result, assay_run, request, location, box, container, plate, batch | See Schema table for more information |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| position | Field number in schema | Integer | 0, 1, 5, etc | 0 = 1st field.1 = 2nd field...etc |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| type | Selected type of entities for a schema object | dna_sequence, aa_sequence, custom_entity, entry | dna_sequence, aa_sequence, custom_entity, entry | Oligo schema are listed as dna_sequence types |
| display_name | Display name of schema in Benchling | Text | "Cell Line" | |
| numeric_min | Minimum numeric value given for object | Integer | 0, 1, 5, etc | precision limited by number of significant figures |
| numeric_max | Maximum numeric value given for object | Integer | 0, 1, 5, etc | precision limited by number of significant figures |
| is_multi | Single or multi option identifier | TRUE, FALSE | TRUE, FALSE | |
| is_required | Identifier whether field is required or not | TRUE, FALSE | TRUE, FALSE | |
| dropdown_id | unique id of dropdown table | Foreign key for dropdown_id in the field definition table | sfs_ZVmOP8Ed | dropdown_id also found in the URL for the dropdown in the Registry settings page |
| target_schema_id | ID of target schema that points to the relationship link | Foreign key for entity_schema.id | ts_XDQ0OW6s | |
Applied filter(s): LINKED_FIELD_IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| schema_id | Unique identifier for schema containing object | Foreign key for schema.id | ts_IOGwR6u4 | |
| field_defiintion_id | Unique id of field definition for object in table | Foreign key for field_defition.id | schema_field_42365 | See field_definition Table |
| field_name | Display name for field on schema | Text | "Date Sequenced" | |
| batch_id | Unique identifier for batch object | Foreign key for batch.id | bat_Gs8PtV0K | What batch is in the container |
| box_id | Unique ID for box object | Foreign key for box.id | box_oz4ZE0MN | |
| container_id | Unique ID for container object | Foreign key for container.id | con_gQMDFBm4 | |
| entry_id | Unique identifier for Entry | Foreign key for entry.id | etr_GtcscEZq | See Entry Table for more information |
| location_id | Unique ID for location that contains object | Foreign key for location.id | loc_Y2v8daz0 | |
| plate_id | Unique ID for plate object | Foreign key for plate.id | plt_K9VZG06I | |
| registry_entity_id | unique id of any registered entity | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| request_id | Unique identifier for the request | Foreign key for request.id | req_qPtu1MSo | |
| run_id | Unique identifier for the run | Foreign key for assay_run.id | multi_a11d82b2-8df3-44ae-bb2e-89086c8b69a4_file | |
| display_value | Text value of identified field | Text | "Amp" | |
| blob_value | Blob link value in JSON format of identified field | JSON value | {id, name, url} | Attached file can be found in Benchling |
| float_value | Floating point value of identified field | Floating Point | 2, 4.56, 4334.6493, etc | |
| date_value | Date format value of identified field | datetime | 1/8/20 | |
| datetime_value | Date format with timestamp value of identified field | Timestamp with timezone | 2019-12-05T19:15:00 | |
| integer_value | Integer value of identified field | Integer | 1, 2, 54, etc | |
| json_value | JSON value of identified field | JSON Value | | |
| linked_batch_id | Unique id of any batch the field object is linked to | Foreign key for batch.id | bat_Gs8PtV0K | |
| linked_box_id | Unique id of any box the field object is linked to | Foreign key for box.id | box_oz4ZE0MN | |
| linked_container_id | Unique id of any container the field object is linked to | Foreign key for container.id | con_gQMDFBm4 | |
| linked_entry_id | Unique id of any entry the field object is linked to | Foreign key for entry.id | etr_GtcscEZq | |
| linked_location_id | Unique id of any location the field object is linked to | Foreign key for location.id | loc_Y2v8daz0 | |
| linked_plate_id | Unique id of any plate the field object is linked to | Foreign key for plate.id | plt_S5ALalNc | |
| linked_result_id | Unique id of any result the field object is linked to | Foreign key for result.id | 6498dd5a-1b4b-4954-826f-bfcfd1496373 | |
| linked_run_id | Unique id of any run the field object is linked to | Foreign key for run.id | 343494f6-e633-4523-9aa6-26898c99f482 | |
| linked_registry_entity_id | Unique id of any registered entity the field object is linked oo | Foreign key for registry_entity.id | bfi_cooUBrYb | |
| value_index | The position number of a given value for a field that supports multiple values | Integer(or null) | null, 1, 2, 6, etc | "null" = Not Multiselect.1,2,3,4, etc = Position of multi-select field |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Character Varying | sfs_jBu9uUnv, etc. | Primary key for a table |
| name | Name of dropdown in Benchling | Character Varying | Color, Analytes, etc. | |
| archived$ | Archival state for dropdown in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for dropdown in Benchling | Character Varying | null, Made in Error, Retired, Other, etc | null = object not archived |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Character Varying | sfso_2v93jfF9, etc. | Primary key for a table |
| dropdown_id | Reference to parent dropdown ID | Character Varying | sfs_jBu9uUnv, etc. | Refers to dropdown.id |
| name | Name of dropdown option in Benchling | Character Varying | Color, Analytes, etc. | |
| position | Relative position of dropdown option in the dropdown | Integer | 0, 3, etc. | Ranges from 0 to (# options in dropdown - 1) |
| archived$ | Archival state for dropdown option in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for dropdown option in Benchling | Character Varying | null, Made in Error, Retired, Other, etc | null = object not archived |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| url | url for each object in Benchling | Browser URL | https://demo.benchling.com/#biotech-org/f/lib_J3tmt8BP-Entry%20Namet/etr_gRogHFOb-untitled/edit | |
Applied filter(s): IS_NOT_ARCHIVED
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| archived$ | Archival state for object in Benchling | Boolean | TRUE, FALSE | true = object archived |
| archive_purpose$ | Archival reason for object in Benchling | Text | null, Made in Error, Retired, Other, etc | null = object not archived |
| created_at | Created date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| modified_at | Most recent modified date for object | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| parent_folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_J3tmt8BP | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| handle | Unique username chosen by individual users or username defined for a Benchling Apps | Text | "ssiegfried" | Handle can be changed at any point to any other unique string of text/integers |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| email | Unique email associated with each user account , column will be null for Benchling App accounts | Email | "[email protected]" | |
| is_suspended | Suspension status for each user or app | FALSE, TRUE | FALSE, TRUE | TRUE = Suspended user |
| created_at | Created date for user or app | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| handle | Unique username chosen by individual users | Text | "ssiegfried" | Handle can be changed at any point to any other unique string of text/integers |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| email | Unique email associated with each user account | Email | "[email protected]" | |
| is_suspended | Suspension status for each user | FALSE, TRUE | FALSE, TRUE | TRUE = Suspended user |
| created_at | Created date for user | Timestamp without timezone | 2019-12-06T23:24:44.885478 | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| team_id | Unique identifier for the assignee's team | Foreign key for team.id | team_oh5xGqrm | |
| user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | See User Table for more information |
| role | Team membership status for an individual user | ADMIN, MEMBER | ADMIN, MEMBER | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| name | Name of object in Benchling | Character Varying | Transfection Entry, QC Results, Therapeutic Cell Line, etc | |
| description | Description given to object | Text | "Fermentation Workflow" | |
Note: These tables exist only in their $raw form; consider performing a JOIN on the relevant schema table.
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Unique identifier for the request | Character Varying | Transfection Entry, Therapeutic Cell Line | |
| bases | A string representing the bases that make up the DNA Sequence | Character Varying | agtctgttgggatggccacttaccacatcgtaccccta [...] | |
| bases_length_exceeds_limit | Whether or not the length of the bases
field exceeds the limit | Boolean | false | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | ent_yXrL3BjX, etr_GtcscEZq, loc_Y2v8daz0, etc | Primary key for a table |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | If an object isn't in a project, the permissions will be derived from the Registry |
| name | Unique identifier for the request | Character Varying | Transfection Entry, Therapeutic Cell Line | |
| bases | A string representing the bases that make up the DNA Oligo | Character Varying | agtctgttgggatggccacttaccacatcgtaccccta [...] | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | prs_hVI52tJk | |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | |
| name | Name of object in Benchling | Character varying | Analytical SEC 26 | |
| display_id | Unique identifier surfaced in the actual Benchling site | Prefix-unique number | SEC26 | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| modified_at | Most recent modified date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| url | URL for each object in Benchling | Browser URL | https://demo.benchling.com/demo/f/lib_LDMZLtYM-media-prep/prs_hVI52tJk--analytical-sec-26/edit | |
| folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_LDMZLtYM | |
| execution_type | Selected type for how tasks are executed | ENTRY, DIRECT | ENTRY, DIRECT | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
| archive_purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| workflow_flowchart_node_config_id | Unique identifier for workflow_flowchart_node_config | Foreign key for workflow_flowchart_node_config.id | wffcnc_giVNQcTL | |
| workflow_flowchart_config_version_id | Unique identifier for workflow_flowchart_config_version | Foreign key for workflow_flowchart_config_version.id | wffccv_giVNQcAF | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | prstsch_0JAxhOhS | |
| schema_type | Schema type selected for schema of object | Text | workflow_task | Always workflow_task for this table |
| name | Name of object in Benchling | Character varying | Analytical SEC | |
| system_name | Name of warehouse table for this schema | Character varying | analytical_sec | |
| execution_type | Selected type for how tasks are executed | ENTRY, DIRECT | ENTRY, DIRECT | |
| prefix | Prefix used when creating workflow tasks from this schema | Character varying | SEC | |
| workflow_task_group_prefix | Prefix used when creating workflow task groups from this schema | Character varying | SEC | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| modified_at | Most recent modified date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| url | URL for each object in Benchling | Browser URL | https://demo.benchling.com/demo/f/lib_LDMZLtYM-media-prep/prs_hVI52tJk--analytical-sec-26/edit | |
| can_set_assignee_on_task_creation | Determines if assignees can be set when a task is created | Boolean | TRUE, FALSE | |
| folder_id | Unique identifier for folder containing object | Foreign key for folder.id | lib_LDMZLtYM | |
| workflow_task_status_lifecycle_id | Unique identifier for workflow_task_status_lifecycle | Foreign key for workflow_task_status_lifecycle.id | prstswf_J8s40D7l | |
| default_responsible_team_id | Unique identifier for team | Foreign key for team.id | team_oh5xGqrm | |
| default_creation_folder_id | Unique identifier for default folder where tasks of this schema are created | Foreign key for folder.id | lib_LDMZLtYM | |
| default_entry_execution_folder_id | Unique identifier for default folder where tasks of this schema are executed | Foreign key for folder.id | lib_LDMZLtYM | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
| archive_purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wftask_hVI52tJk | |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | |
| display_id | Unique identifier surfaced in the actual Benchling site | Prefix-unique number | SEC26-T5 | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| modified_at | Most recent modified date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| scheduled_on_date | Date the task is scheduled to be performed | Date | 2020-06-04 | |
| assignee_id | Unique identifier for assigned user | Foreign key for user.id | ent_yXrL3BjX | |
| workflow_task_group_id | Unique identifier for workflow_task_group | Foreign key for workflow_task_group.id | prs_hVI52tJk | |
| workflow_task_schema_id | Unique identifier for workflow_task_schema | Foreign key for workflow_task_schema.id | prstsch_0JAxhOhS | |
| workflow_task_status_id | Unique identifier for workflow_task_status | Foreign key for workflow_task_status.id | wfts_A6CmVrOp | |
| execution_entry_id | Unique identifier for entry | Foreign key for entry.id | etr_GtcscEZq | |
| execution_user_id | Unique identifier for user | Foreign key for user.id | ent_yXrL3BjX | |
| executed_on | Date the task was executed | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| archived$ | Archival state for object in Benchling | Boolean | FALSE, TRUE | |
| archive_purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| workflow_flowchart_id | Unique identifier for workflow_flowchart | Foreign key for workflow_flowchart.id | wffc_giVNQcAF | |
| workflow_flowchart_task_id | Unique identifier for a flowchart workflow_task | Foreign key for workflow_task.id | wftask_OnnsW08k | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | prsosch_kz6y7T4o | |
| schema_type | Schema type selected for schema of object | Text | workflow_output | Always workflow_output for this table |
| name | Name of object in Benchling | Character varying | Analytical SEC | |
| system_name | Name of warehouse table for this schema | Character varying | analytical_sec | |
| prefix | Prefix used when creating workflow tasks from this schema | Character varying | SEC | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
| archive_purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wftask_hVI52tJk | |
| source_id | The project or registry that the object's permissions comes from | Foreign key for project.id or registry.id | src_hh9ffHqV | |
| display_id | Unique identifier surfaced in the actual Benchling site | Prefix-unique number | SEC26-T5 | |
| creator_id | Unique identifier for creator of object | Foreign key for user.id | ent_yXrL3BjX | |
| created_at | Created date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| modified_at | Most recent modified date for object | Timestamp without time zone | 2020-06-04T00:11:56.132400 | |
| workflow_task_group_id | Unique identifier for workflow_task_group | Foreign key for workflow_task_group.id | prs_hVI52tJk | |
| workflow_task_id | Unique identifier for workflow_task that output is for | Foreign key for workflow_task.id | wftask_hVI52tJk | |
| workflow_task_status_id | Unique identifier for workflow_task_status | Foreign key for workflow_task_status.id | wfts_A6CmVrOp | |
| workflow_output_schema_id | Unique identifier for workflow_output_schema | Foreign key for workflow_output_schema.id | prsosch_kz6y7T4o | |
| archived$ | Archival state for object in Benchling | boolean | FALSE, TRUE | |
| archive_purpose$ | Archival reason for object in Benchling | Character varying | null, Made in Error, Retired, Other, etc | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wfts_A6CmVrOp | |
| display_name | Name of object in Benchling | Character varying | Completed | |
| status_type | Type of status | PENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID | PENDING, IN_PROGRESS, COMPLETED, CANCELLED, FAILED, INVALID | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | prstswf_J8s40D7l | |
| name | Name of object in Benchling | Character varying | Entry Review | |
| schema_execution_type | Type of execution for task schemas using this lifecycle | DIRECT, ENTRY | DIRECT, ENTRY | |
| initial_workflow_task_status_id | Unique identifier for workflow_task_status | Foreign key for workflow_task_status.id | wfts_A6CmVrOp | The first status of the lifecycle.lifecycle edges determine the rest of the status order. |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | prstswfe_aziohrUt | |
| workflow_task_status_lifecycle_id | Unique identifier for workflow_task_status_lifecycle | Foreign key for workflow_task_status_lifecycle.id | prstswf_J8s40D7l | Lifecycle that the edge is for |
| from_workflow_task_status_id | Unique identifier for workflow_task_status | Foreign key for workflow_task_status.id | wfts_A6CmVrOp | The starting status of the edge |
| to_workflow_task_status_id | Unique identifier for workflow_task_status | Foreign key for workflow_task_status.id | wfts_Td7q3eiM | The ending status of the edge |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffc_giVNQcAF | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffcnc_giVNQWcXS | |
| workflow_task_schema_id | Unique identifier for workflow_task_schema | Foreign key for workflow_task_schema.id | prstsch_OnnsV06w | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffcec_poVNQcQE | |
| workflow_flowchart_id | Unique identifier for workflow_flowchart | Foreign key for workflow_flowchart.id | wffc_giVNQcAF | |
| from_flowchart_node_config_id | Unique identifier for workflow_flowchart_node_config | Foreign key for workflow_flowchart_node_config.id | wffcnc_mcMKcXS | |
| to_node_config_id | Unique identifier for workflow_flowchart_node_config | Foreign key for workflow_flowchart_node_config.id | wffcnc_nwICpoe | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wfle_kmQWplX | |
| to_workflow_task_id | Unique identifier for workflow_task | Foreign key for workflow_task.id | wftask_OnnsW08k | |
| from_workflow_task_id | Unique identifier for workflow_task | Foreign key for workflow_task.id | wftask_OnnsW08k | |
| to_workflow_output_id | Unique identifier for workflow_output | Foreign key for workflow_output | wfout_5cJLQKVF | |
| from_workflow_output_id | Unique identifier for workflow_output | Foreign key for workflow_output.id | wfout_5cJLQKVF | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffccv_giVNQcAF | |
| workflow_flowchart_config_id | Unique identifier for workflow_flowchart_config | Foreign key for workflow_flowchart_config.id | wffcc_wcIJAPL | |
| workflow_flowchart_id | Unique identifier for workflow_flowchart | Foreign key for workflow_flowchart.id | wffc_giVNQcAF | |
| Table Row | Definition | Value Type | Example values (if applicable) | Notes |
|---|
| id | Unique Benchling-prescribed ID for each line item in table | Format dependent on table | wffcc_wcIJAPL | |
| workflow_task_schema_id | Unique identifier for workflow_task_schema | Foreign key for workflow_task_schema.id | prstsch_OnnsV06w | |